ID: 1140865540

View in Genome Browser
Species Human (GRCh38)
Location 16:79057868-79057890
Sequence TTCCATATCCATAATGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140865536_1140865540 28 Left 1140865536 16:79057817-79057839 CCAAGTTCCGCTGAGACTCCATT 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1140865540 16:79057868-79057890 TTCCATATCCATAATGTGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 180
1140865539_1140865540 -1 Left 1140865539 16:79057846-79057868 CCTGTTGTATCATCTGAATTATT 0: 1
1: 0
2: 1
3: 26
4: 237
Right 1140865540 16:79057868-79057890 TTCCATATCCATAATGTGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 180
1140865537_1140865540 21 Left 1140865537 16:79057824-79057846 CCGCTGAGACTCCATTTACTCAC 0: 1
1: 0
2: 2
3: 57
4: 370
Right 1140865540 16:79057868-79057890 TTCCATATCCATAATGTGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 180
1140865538_1140865540 10 Left 1140865538 16:79057835-79057857 CCATTTACTCACCTGTTGTATCA 0: 1
1: 0
2: 2
3: 15
4: 171
Right 1140865540 16:79057868-79057890 TTCCATATCCATAATGTGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140865540 Original CRISPR TTCCATATCCATAATGTGCA AGG Intronic
902420678 1:16277432-16277454 TTCCATATCCAGGCTGGGCATGG + Intronic
905330736 1:37194788-37194810 GCTCATATCCAAAATGTGCAAGG + Intergenic
905851931 1:41281044-41281066 TTCCTTATCCATGAAGGGCATGG + Intergenic
907658038 1:56364964-56364986 TTCCAAGTCCAAAATATGCAGGG + Intergenic
908902515 1:68971849-68971871 AGCCATATCCATTATGTGCTTGG + Intergenic
911898159 1:103466462-103466484 TTCTATATCCATACCTTGCAAGG + Intergenic
912032137 1:105261984-105262006 GCCCATATCCAGAATATGCAAGG - Intergenic
913362351 1:117995555-117995577 TTCCATATTCACAAAGAGCAAGG + Intronic
915787704 1:158634222-158634244 TTCAAAATCTATAATCTGCAAGG + Intronic
916354524 1:163889936-163889958 GTCCATATCCAGAATATGTATGG + Intergenic
917562850 1:176177957-176177979 TTGCATATCCGTTATGTGCCTGG - Intronic
918579187 1:186105425-186105447 ATCCACATCCATAATGTACCAGG - Intronic
918667873 1:187174558-187174580 ATTCCTATCAATAATGTGCAAGG - Intergenic
918744100 1:188177209-188177231 TTACATATCCATAAGAGGCATGG - Intergenic
918794340 1:188873600-188873622 GTCCTTATCCATAAAGTGCAAGG - Intergenic
920712191 1:208305918-208305940 TTGCATATATATTATGTGCAAGG + Intergenic
920911718 1:210224520-210224542 TTCCATATGTATAAAGTGAAGGG + Intergenic
921497852 1:215862673-215862695 TTCTATTTCTAAAATGTGCATGG - Intronic
921850651 1:219928993-219929015 TTCCATATTAATCAGGTGCAAGG + Intronic
923637319 1:235712519-235712541 TTGAATACCCATTATGTGCAAGG - Intronic
924826942 1:247549720-247549742 TCCCGCATCCATAATTTGCAAGG - Intronic
1064069348 10:12212834-12212856 TTGCATATACATAATGGGGATGG - Intronic
1065719146 10:28608702-28608724 TTCTATATACATAATGTGTATGG + Intronic
1067814205 10:49459618-49459640 TTCCTTATCCACAGTGTACAGGG - Intronic
1070356692 10:75647050-75647072 CTCCATCTCCCTAATCTGCATGG - Intronic
1072182857 10:93005006-93005028 CTTCATATCTATTATGTGCATGG + Intronic
1072860816 10:99003703-99003725 GTTCATATCCAAAATGTGTAAGG - Intronic
1073343861 10:102767189-102767211 TGCCATCTCCAGAATGTGCAGGG - Intronic
1074675653 10:115847714-115847736 GTGCACATCCATAGTGTGCAAGG + Intronic
1079596120 11:22249820-22249842 AACCATATCCAAAATCTGCATGG - Intronic
1081129455 11:39360438-39360460 TTCCTTCTCCATAAGGTGGAAGG + Intergenic
1081588488 11:44404209-44404231 TTCCATTTCTTTAAAGTGCAAGG + Intergenic
1082731885 11:56808145-56808167 TTCCTTATCCAAAATGTGTAAGG + Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085858176 11:80199483-80199505 TTCCATAACCTAAAAGTGCAAGG + Intergenic
1086355656 11:85996510-85996532 TTCCATAACCAGAAAATGCATGG - Intronic
1087501253 11:98956997-98957019 TTCTATATATATAATGAGCAGGG - Intergenic
1087577052 11:100001633-100001655 TTGAATATCTATAATATGCACGG - Intronic
1088969174 11:114756754-114756776 TTCCATATTCATAAAGTGAAGGG + Intergenic
1089688137 11:120169802-120169824 TTCCAGATCCATCATGAGGATGG - Exonic
1091345998 11:134854602-134854624 CTCCATGTGCAGAATGTGCAGGG + Intergenic
1091426093 12:390667-390689 TTCCAAGTCCAAAATCTGCAGGG - Intronic
1092075364 12:5668426-5668448 TTTAATATCCAGAATCTGCAAGG - Intronic
1093744314 12:22722300-22722322 TTTCATATCCATGAAGTGCCTGG - Intergenic
1094067730 12:26379108-26379130 TGCCATGCCCATAATGTGCCAGG - Intronic
1097547160 12:61018149-61018171 TGCCATGTCCAAAATCTGCAGGG - Intergenic
1098524690 12:71473188-71473210 TGCCAGATCCATGATGTGCTGGG - Intronic
1098609552 12:72438384-72438406 ATTCCTATCAATAATGTGCAAGG + Intronic
1099097245 12:78389962-78389984 TTGCATATCCATTATCTCCATGG - Intergenic
1101681510 12:106971722-106971744 TTCCATATGTATAATGTGCCAGG + Exonic
1103884477 12:124190369-124190391 TTCCATCTCCAGAATGTCCTTGG + Intronic
1105745355 13:23373026-23373048 TCCCATATCCATGCTTTGCAGGG + Intronic
1105792308 13:23814134-23814156 TTCAATTTCCATAATTTCCAAGG + Intronic
1106009627 13:25806908-25806930 TTCCATTTCCATGATGAGTAAGG + Intronic
1106410521 13:29508141-29508163 CTTCATAACCAAAATGTGCAAGG + Intergenic
1108054117 13:46468855-46468877 TTCCATATACATAATGTATAGGG + Intergenic
1108107993 13:47033913-47033935 TTCCAAACCCATAACTTGCATGG + Intergenic
1108281131 13:48863324-48863346 TTCCATAAACATAATGTGTCAGG + Intergenic
1108898113 13:55360817-55360839 TTCTATATCATTTATGTGCATGG + Intergenic
1110324925 13:74202704-74202726 TTCCATATCCAAATTATGGAAGG + Intergenic
1111334989 13:86808982-86809004 TTCCATATGCAGGATGTTCATGG - Intergenic
1119152892 14:72380426-72380448 GTCAATATCCAGAATATGCAAGG + Intronic
1120549966 14:85858428-85858450 TTGAATATCCATTATGTGCCAGG + Intergenic
1122466989 14:101940503-101940525 TTCTCTATCCAGAATGTGCATGG - Intergenic
1123586800 15:21768102-21768124 TTTAATATCCAGAATCTGCAAGG + Intergenic
1123623439 15:22210667-22210689 TTTAATATCCAGAATCTGCAAGG + Intergenic
1124918793 15:34003565-34003587 ATCCATATCCATAAATTGAAAGG - Intronic
1126513955 15:49513480-49513502 TTTAATATCCAGAATGTACAAGG - Intronic
1126718059 15:51543383-51543405 TTCCATATGCAAAATGAGAAGGG - Intronic
1131608354 15:93933790-93933812 ATGCAAATCCAAAATGTGCAAGG + Intergenic
1133045506 16:3086477-3086499 TTTCTTATTGATAATGTGCATGG + Intergenic
1133891937 16:9887399-9887421 TTCCATTTACATAAAGTTCAAGG - Intronic
1138963364 16:62053728-62053750 GTCCATATGCATAAACTGCAAGG - Intergenic
1140865540 16:79057868-79057890 TTCCATATCCATAATGTGCAAGG + Intronic
1142946199 17:3430543-3430565 TTTAATATCCAAAATGTACAAGG + Intergenic
1144909154 17:18666453-18666475 TCCCATGTACATAATGTGCTAGG + Intronic
1148923162 17:51057947-51057969 TTAAATATCCATAATTTGCTTGG - Intronic
1154359834 18:13650431-13650453 CTACATATATATAATGTGCACGG - Exonic
1156548730 18:37992086-37992108 TTACATATCTATTATGTGCAAGG - Intergenic
1156787822 18:40937052-40937074 CTCCATATCCATTCTCTGCATGG + Intergenic
1159096769 18:63911162-63911184 TTTAATATCCATTATGTACAAGG - Intronic
1159584167 18:70267307-70267329 TTCCATGTCCATATTTTGTAGGG - Intergenic
1160346913 18:78139646-78139668 TTCCCTATCCATCAGTTGCAGGG + Intergenic
1162785245 19:13030800-13030822 TTCCAGCTACATACTGTGCAGGG + Intronic
1165779019 19:38421356-38421378 TTCCTTATCTGTATTGTGCATGG + Intronic
1167832320 19:52035345-52035367 TTCCAAATGCATTATGTTCATGG + Exonic
1167941282 19:52947448-52947470 TTCCACATCAATAAAGTCCAAGG + Intronic
1168517646 19:57021794-57021816 TTGCAGATTCATAAAGTGCAAGG + Intergenic
931958426 2:67454011-67454033 TACCATATCCATGATATTCATGG + Intergenic
933343622 2:81053857-81053879 TTAAATATCCACAATATGCAAGG - Intergenic
935364492 2:102275169-102275191 TGACATTTACATAATGTGCAGGG - Intergenic
936790585 2:116146372-116146394 TTATATATTCATAATGTTCAGGG - Intergenic
941525676 2:166603769-166603791 ATCCATATCCAGAGTGTCCATGG + Intergenic
941978149 2:171427862-171427884 TTTTTCATCCATAATGTGCAGGG - Intronic
944268542 2:197755009-197755031 TCCAATATCCATAATGTACAAGG + Intronic
946630766 2:221665938-221665960 TTTCATTTCCATAATGTTCTTGG + Intergenic
947405115 2:229767878-229767900 TTCAATATACATTAAGTGCAAGG + Intronic
1169615327 20:7437155-7437177 TTCTATATCCAAAAGGTGAAGGG - Intergenic
1170397177 20:15939092-15939114 TTCCATTACATTAATGTGCAAGG + Intronic
1171445736 20:25203387-25203409 TTAGATTTCCATAATGTGCATGG + Intronic
1172024299 20:31937482-31937504 TTCCATGTCCACAACATGCAGGG - Exonic
1175747392 20:61467708-61467730 TTCCATATCCATCATCTTTATGG + Intronic
1177279469 21:18961983-18962005 TTCCACTTCCATAAACTGCAAGG - Intergenic
1178008516 21:28254038-28254060 TCCCATATCCATAATAAGGATGG - Intergenic
1178042186 21:28651261-28651283 TTCTTTATCCATAATTTGCATGG - Intergenic
1181529046 22:23505740-23505762 TTCCATGTCCACTGTGTGCAGGG - Intergenic
1182064006 22:27417631-27417653 TTCCCTGTACATAATGAGCAGGG - Intergenic
1182991855 22:34775900-34775922 TTGCATATTCACTATGTGCAGGG - Intergenic
1184679118 22:46061091-46061113 TTTCTTAACCATAATGTGCCAGG + Intronic
951755088 3:26082192-26082214 TGCCATATCCAGAATGTTTATGG + Intergenic
952007513 3:28858837-28858859 TTCCATATCTAGTATCTGCAAGG - Intergenic
952143098 3:30501282-30501304 TTCCATATACTTAATGAGCATGG - Intergenic
955419840 3:58725165-58725187 TACCATGTCCTTTATGTGCAAGG + Intronic
957730711 3:84130628-84130650 TTCCATTTACATAATGTTCCTGG - Intergenic
958588420 3:96120885-96120907 TTCCAAATTCACAAGGTGCAAGG - Intergenic
959492995 3:107014079-107014101 TTCCATTTATATAATGTTCAAGG + Intergenic
960478710 3:118162117-118162139 TTCAATAACCATAATGATCAGGG - Intergenic
961853667 3:129847565-129847587 TCCCATATCCATCAAGTGTATGG - Intronic
962958013 3:140284413-140284435 TTCCACATATATAATGTTCATGG + Intronic
964313929 3:155423588-155423610 TTTCATGGCCATAATGTACAGGG + Intronic
964959149 3:162403064-162403086 TTCCATTCCCATAATGCTCATGG + Intergenic
966053093 3:175646408-175646430 TTCCATATCACTTATGTGGATGG + Intronic
966214098 3:177483503-177483525 TTCCTTATCCATAAGATTCAGGG + Intergenic
966619139 3:181945295-181945317 TTGCATACCCACTATGTGCATGG + Intergenic
968537728 4:1145199-1145221 TGCCATTTCCATGATATGCACGG - Intergenic
968537922 4:1146342-1146364 TGCCATTTCCATGATATGCACGG - Intergenic
968537966 4:1146651-1146673 TGCCATTTCCATGATATGCACGG - Intergenic
968538019 4:1146966-1146988 TGCCATTTCCATAATATCCACGG - Intergenic
970209631 4:13695919-13695941 TTCCATTTCCTTTATGTGGATGG - Intergenic
971662908 4:29443100-29443122 TGGCAAATCCAAAATGTGCATGG - Intergenic
972690600 4:41394127-41394149 TTCCATTTCCGTAGTGTGCTAGG + Intronic
974634270 4:64538958-64538980 TTCCAAATCAATAATGGGCAGGG + Intergenic
975443910 4:74440850-74440872 TTTCAAACCCATAATGTTCAAGG - Intergenic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
980474151 4:133289720-133289742 TTCCATATGCTTGAGGTGCAAGG - Intergenic
981917058 4:150045982-150046004 TTACATATCCATAATATGCTTGG + Intergenic
982097935 4:151940277-151940299 ATCTATATCTATAATGTACATGG - Intergenic
982285665 4:153731539-153731561 TTTCAGATTCATTATGTGCATGG - Intronic
982686795 4:158500371-158500393 GTACATGTGCATAATGTGCAGGG + Intronic
984140481 4:175999548-175999570 CTTCATATCCATAATGCACAAGG - Intronic
984429908 4:179636388-179636410 TTCCATATGCATAATCTACCTGG + Intergenic
987544514 5:19295666-19295688 CTCCATAACCTAAATGTGCAAGG + Intergenic
988368446 5:30334041-30334063 ATCAATATCCAGAATATGCAAGG + Intergenic
993921000 5:93802025-93802047 TTCAATATTCAGAATATGCATGG - Intronic
994867759 5:105299389-105299411 TTACATACCCACAATGTACAAGG - Intergenic
1000596681 5:163222665-163222687 TTTCATATAAATAATGTGTAAGG + Intergenic
1003998475 6:11568046-11568068 TTGCATATCCATTATGTTCTAGG - Intronic
1008146225 6:47894773-47894795 TTCCATCTTGATAATGTCCATGG + Intronic
1009425616 6:63510574-63510596 TTCAATATCTATTATGTGCCAGG + Intergenic
1009989839 6:70828656-70828678 TTCTATTTCCACAATGTGGAAGG - Intronic
1010028595 6:71248326-71248348 TTCCATACCCATATTAGGCAAGG + Intergenic
1011223754 6:85084931-85084953 ATACATGTGCATAATGTGCAAGG - Intergenic
1013286220 6:108684214-108684236 TCCCATGTACATAATGTGCTAGG - Exonic
1013650185 6:112187062-112187084 TTCCTTAGCCTTAATTTGCAAGG - Intronic
1013657988 6:112265364-112265386 TTATATATCCATAATATGTAAGG + Intergenic
1014470889 6:121813589-121813611 TTCCAGATGCAAAATGTGCCAGG + Intergenic
1016176120 6:141079577-141079599 TTTAATTTCCATAATTTGCATGG - Intergenic
1017427155 6:154334357-154334379 TTCCCCATCCATAAAGTGGAAGG + Intronic
1017427550 6:154338333-154338355 TTCCCTATCCATAAAGTGGCAGG - Intronic
1017575092 6:155793386-155793408 TTCCAGCTACATAATTTGCAAGG - Intergenic
1018429467 6:163712254-163712276 TTCCAGACTCATAATGTGCACGG - Intergenic
1019113049 6:169733164-169733186 TCTAATATCCATAATTTGCAAGG - Intergenic
1019650207 7:2152771-2152793 TTCCACATCCATAAAGTTAACGG - Intronic
1020423852 7:8041352-8041374 AGCCATATCTATAAAGTGCAAGG + Intronic
1021538752 7:21733440-21733462 TTCCAAATACATAAAGTGGAGGG - Intronic
1021896546 7:25241776-25241798 TTCTAAATTCATAATGTGCACGG + Intergenic
1025272481 7:57538052-57538074 GTACATATGCACAATGTGCAAGG + Intergenic
1026245215 7:68613556-68613578 TTACATAGCCATAGCGTGCAGGG - Intergenic
1030622126 7:111801520-111801542 TTCCATACCCATTATGTGTGAGG + Intronic
1031529709 7:122861479-122861501 TTTAATATCCAGAATATGCAAGG - Intronic
1036019800 8:4831851-4831873 TGCCACATCCAGAAGGTGCAAGG + Intronic
1036947031 8:13104057-13104079 TTCAATTTCCATTCTGTGCAAGG - Intronic
1039567635 8:38562912-38562934 TTCCAAATCTGTAATGTTCAAGG + Intergenic
1040836795 8:51740707-51740729 TCTAATATCCATAATCTGCAAGG - Intronic
1042075114 8:64985451-64985473 TTTCATTTCCACAATGTGCATGG + Intergenic
1042474433 8:69231151-69231173 TTCCCTTTCTATTATGTGCAAGG + Intergenic
1043001495 8:74765459-74765481 TCTCATATCCAGAATGTACAAGG + Intronic
1044137496 8:88605431-88605453 TTGTATATCAATAATATGCAGGG + Intergenic
1050069739 9:1798225-1798247 TTCCTCATCCGTAATGTGAAGGG + Intergenic
1051151707 9:14086922-14086944 TGACAGATCCATAGTGTGCATGG - Intronic
1054748657 9:68881840-68881862 TTCCTTCTCCATCATGTGCCTGG + Intronic
1055556386 9:77478060-77478082 GTACATATGCATAATGTGCAGGG + Intronic
1055686009 9:78775500-78775522 TGCCATCACCCTAATGTGCAGGG - Intergenic
1056249589 9:84734119-84734141 TTCCTTCTCCATAAAGTGTAGGG + Intronic
1056668620 9:88603428-88603450 ATACATGTGCATAATGTGCAGGG - Intergenic
1058284278 9:103155875-103155897 TGCTATCTCCAGAATGTGCAGGG + Intergenic
1060257457 9:122045162-122045184 TTCTATATTCTTAATGTGCAAGG - Intronic
1061255067 9:129450480-129450502 TTCCATGTCCACTGTGTGCAAGG + Intergenic
1188456105 X:30368127-30368149 AGCCATCTCCATAAAGTGCAAGG - Intergenic
1188955144 X:36425155-36425177 TTCTATATACAGAATGTACAAGG + Intergenic
1190361336 X:49651946-49651968 TTCTATATGCAAAGTGTGCAAGG - Intergenic
1191152230 X:57231987-57232009 TTCCATATGCATGATATGCTTGG + Intergenic
1192816947 X:74603599-74603621 TTAAATATCCACAATGTGCAAGG - Intronic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1194310198 X:92297026-92297048 TCTAATATCCATAATCTGCAAGG - Intronic
1195162434 X:102183732-102183754 TTCCTCATCTATAATGTGCATGG + Intergenic
1197483916 X:127023605-127023627 TTCCATATGAATACTGTGCTTGG - Intergenic
1198136077 X:133751658-133751680 TTGCTTATCCAAAATGTGGAGGG - Intronic
1198232560 X:134705892-134705914 TGCCTTATACATAATGTTCAGGG - Intronic
1198640882 X:138755237-138755259 TTTAATATCCACAATGTGCAAGG - Intronic
1199693225 X:150324975-150324997 TGCCAAGTCCAAAATGTGCAGGG + Intergenic
1199949267 X:152693502-152693524 TTTAATCTCCATAATGTGGATGG - Intergenic
1199960409 X:152774947-152774969 TTTAATCTCCATAATGTGGATGG + Intergenic
1200618489 Y:5411313-5411335 TCTAATATCCATAATCTGCAAGG - Intronic
1201433894 Y:13935489-13935511 TTCTATATGCTTACTGTGCATGG - Intergenic