ID: 1140866228

View in Genome Browser
Species Human (GRCh38)
Location 16:79064944-79064966
Sequence GTGTTTATAGAGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140866225_1140866228 2 Left 1140866225 16:79064919-79064941 CCAGTGCAAATGGCGCCAGGAAT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG 0: 1
1: 0
2: 2
3: 14
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140866228 Original CRISPR GTGTTTATAGAGATGGAGCA TGG Intronic
900955200 1:5882538-5882560 GTCTTTATGGGGATGTAGCAGGG - Intronic
901254902 1:7815108-7815130 GTATTTTTAGAGATGAAGTATGG - Intronic
902618500 1:17636978-17637000 GTGATGATACAGATGGAGTAAGG - Intronic
903975564 1:27147634-27147656 GTTTTTTTAGAGATGGGGGATGG - Intronic
904588783 1:31595836-31595858 GAGTTTATAGTCATGGAGCAGGG - Intergenic
905434017 1:37944757-37944779 TTTTTTGTAGAGATGGAGCCGGG + Intronic
906196965 1:43935645-43935667 GTGTTGATAGAGATGGAACTTGG + Exonic
906480677 1:46197365-46197387 TGGTTTCTAGAGATGGAGCCAGG + Intronic
907366627 1:53966201-53966223 GTGTTTATGGAGAGGGAAAAAGG + Intronic
908377180 1:63555467-63555489 TTGTATATAGAGATGAAACAGGG + Exonic
909700856 1:78521077-78521099 GTGTCTATAGAGCTGGGGGATGG - Intronic
910789133 1:91032963-91032985 GTGTTTTTAAAGAGAGAGCATGG + Intergenic
911232668 1:95377498-95377520 GTGATGTTAGAGATGGACCATGG + Intergenic
913360435 1:117974933-117974955 GTTTGCATAGAGATGGAGGATGG - Intronic
914826665 1:151142463-151142485 TTGTTCACAGAGATGGGGCAAGG + Intronic
916509223 1:165456532-165456554 GTGGTTGTAGAGATAGTGCAGGG + Intergenic
917864668 1:179182168-179182190 GTGATTATAATGATGGACCATGG - Intronic
918445446 1:184612667-184612689 TTGTTTTTTGAGATGGAGCCTGG - Intronic
920407964 1:205733424-205733446 GTGTTTCTAGTGATAGAGTAAGG - Intronic
920669263 1:207990880-207990902 GTCTGCATAGAGATGGGGCAGGG - Intergenic
922002753 1:221496517-221496539 GTGTTTAGTGAGAAGGAGCCTGG + Intergenic
922656121 1:227385233-227385255 TTGTTTTTTGAGATGGAGCCTGG - Intergenic
923540297 1:234884013-234884035 GTGGTTATAGACATGGTTCATGG + Intergenic
1064794929 10:19000713-19000735 GTGTTTATATGGAAGTAGCATGG - Intergenic
1068433645 10:56963544-56963566 GTGTGTGTAGACATGGAGCTGGG - Intergenic
1068478321 10:57556833-57556855 GTCTTTATAGAGAAAGAACAAGG - Intergenic
1070607907 10:77912259-77912281 TTATTTATAGAGATGGGGTAGGG + Intronic
1071519446 10:86319980-86320002 GTGCTTATGGAGGTGCAGCAGGG - Intronic
1072880283 10:99220192-99220214 GTGTTTAAAGAGATGTTACAGGG + Intronic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1080739672 11:35052074-35052096 GTGATTAGATAAATGGAGCAGGG - Intergenic
1080766012 11:35297340-35297362 GAATTTATAGCCATGGAGCAAGG - Intronic
1080880525 11:36315975-36315997 CTGTTCATGGAGATGGAGCCTGG + Intronic
1081648716 11:44808484-44808506 GTGTTTCTAGAGTGGGAACATGG + Intronic
1082998532 11:59271750-59271772 GTGTTCATGGAGATTGAACAGGG - Intergenic
1083604883 11:63972540-63972562 GTGTTTGTAGAGCTGGAGGGGGG - Intergenic
1085026979 11:73242086-73242108 GTGTGTAGAGAGCTGGGGCAAGG + Intergenic
1087067823 11:94044082-94044104 GTATTTATGGAGCTGGAGCTAGG + Intronic
1088311654 11:108467014-108467036 GTTTTTTTAGAGATGGAAAAGGG - Intronic
1090412210 11:126517054-126517076 TTGTTTTTTGAGATGGAGCCTGG - Intronic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1091993404 12:4974190-4974212 ATGTTTATAGAAATGGAAGAAGG - Intergenic
1092156769 12:6287638-6287660 TTTTTTGTAGAGATGGAGCTTGG - Intergenic
1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG + Intergenic
1095045758 12:37502272-37502294 CAGTTTATGGAGATGAAGCAAGG - Intergenic
1096505422 12:52089422-52089444 GTTTTTGTAGAGATGGGGAAGGG - Intergenic
1099135428 12:78892511-78892533 GTGTTTAGAGAGGTGGGGAAAGG - Intronic
1099278085 12:80603813-80603835 GTGATGATACAGATGGGGCAGGG - Intronic
1101454823 12:104820120-104820142 GTGTTGATAGGAATGGAGGAAGG - Intronic
1102168256 12:110822947-110822969 GTGTTTCCAGAAATGAAGCAAGG - Intergenic
1103377314 12:120467487-120467509 GTATTTATTGAGATGGAGTCTGG - Intronic
1104111658 12:125710298-125710320 GTTTTTATAGAAAGGGAGGAAGG + Intergenic
1105787305 13:23762257-23762279 TAGTTTATAGAGTTGTAGCAAGG - Intronic
1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG + Intergenic
1109652466 13:65347527-65347549 ATAATTATAGAGATGGAACATGG - Intergenic
1110252486 13:73396320-73396342 GTGTTGATAGAGTTGGAGTTAGG + Intergenic
1113305736 13:109076593-109076615 GGATTTCTTGAGATGGAGCATGG - Intronic
1113363970 13:109658997-109659019 GTGTTAAGAGAGATGGAGATAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116125007 14:40772903-40772925 GTGAGGATAGAGATGAAGCATGG - Intergenic
1116676251 14:47909805-47909827 GTGATTATAATGATGGACCATGG - Intergenic
1116797478 14:49407440-49407462 CTGTTTACAGAGATTTAGCAGGG - Intergenic
1117137273 14:52748405-52748427 GTTTTTGTAGAGATGGAGTCTGG + Intronic
1117670422 14:58100532-58100554 GTAATTATAAAGATGGACCAGGG + Intronic
1118448353 14:65872841-65872863 TTGTTTACATAGATGCAGCAAGG + Intergenic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1120486442 14:85119929-85119951 GAGTTTATAGCCAAGGAGCAAGG + Intergenic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1126484406 15:49164077-49164099 CTATTTATAGAGATGGAGGCAGG + Intronic
1127718192 15:61672083-61672105 GAGTTGATAGAGGTGGATCAAGG - Intergenic
1127824718 15:62692715-62692737 GTATTTAGAGAGGAGGAGCAGGG + Intronic
1128310473 15:66628833-66628855 GTGTTTATAAATATGCAGAAGGG + Intronic
1129145852 15:73646678-73646700 TTTTTTATAGAGATGGAGTTTGG + Intergenic
1130145567 15:81271497-81271519 GTGTATATAGATATGGAGACGGG + Intronic
1133218703 16:4308740-4308762 TTTTTTGTAGAGATGGGGCAGGG + Intergenic
1133986698 16:10674296-10674318 ATTTTTATAGGGAGGGAGCAAGG - Intronic
1134611222 16:15610019-15610041 ATGTTAATAGATATGGGGCAGGG - Intronic
1135471346 16:22734297-22734319 GTGTGTACAGAGATGGAGACAGG + Intergenic
1136449609 16:30346318-30346340 GTGTGTGTAGAGATGGAGTCTGG + Intergenic
1136855770 16:33655993-33656015 ATGTTTATAGGGATAGAGGAAGG - Intergenic
1138462216 16:57156602-57156624 GTGGCTACAGAGATAGAGCAAGG + Intronic
1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG + Intergenic
1139579195 16:67862132-67862154 GTGTTTGTAGGGGAGGAGCATGG + Intronic
1139647866 16:68344919-68344941 GTGTGTGTAGAGATGCAGGAAGG - Intronic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1141314443 16:82948010-82948032 GTATTTATGGAGATGTAACATGG + Intronic
1203117355 16_KI270728v1_random:1504474-1504496 ATGTTTATAGGGATAGAGGAAGG - Intergenic
1143334629 17:6163074-6163096 GTGCTGAGAGAGTTGGAGCAGGG - Intergenic
1143849534 17:9799842-9799864 CTGTTTCTTGAGGTGGAGCACGG + Intronic
1144588244 17:16501988-16502010 GAGTTTATAGCCAAGGAGCAGGG - Intergenic
1146135952 17:30321171-30321193 TTTTTTTTAGAGATGGAGCCTGG + Intronic
1146455767 17:33008591-33008613 GTTTTTATTGAGATGGAGTCTGG - Intergenic
1147034742 17:37671592-37671614 GTGTTTGCAGAGGAGGAGCAGGG - Intergenic
1148772005 17:50072720-50072742 GTGATTGCAGGGATGGAGCAAGG + Intronic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1151452664 17:74208211-74208233 GTTTTTAAAGAGTTGGAACAAGG + Intronic
1156570386 18:38245728-38245750 GTTTTTATAGAGAAGGAAAATGG + Intergenic
1158066127 18:53410726-53410748 TTGCTAATAGAGATGGTGCAGGG - Intronic
1160110055 18:76018268-76018290 GTCTTGACAGAGATGGTGCATGG - Intergenic
1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG + Intronic
1160820247 19:1054487-1054509 GTGGTTGTAGAGCAGGAGCAGGG + Intronic
1161141079 19:2648214-2648236 GTTTTTATAGAGATGGCAGATGG - Intronic
1161237924 19:3207118-3207140 GGGTTTGTAGAGATGGAGACTGG - Intronic
1161664749 19:5568418-5568440 GTTTTTGTAGAGATGGGGCCTGG + Intergenic
1164410527 19:28001094-28001116 GTGGTGATAGAGATGGAGAGAGG + Intergenic
1165718351 19:38061671-38061693 GAGTACAGAGAGATGGAGCAGGG + Intronic
1167943180 19:52963584-52963606 TTGTTTATTGAGACGGAGGAGGG - Intergenic
1168495347 19:56843220-56843242 CTGTTTATAGAAATGGGGAAAGG - Intergenic
925681529 2:6427080-6427102 GTGTATATAGACATGGAGGTGGG + Intergenic
925688890 2:6499883-6499905 GAATTCATGGAGATGGAGCAAGG - Intergenic
929241718 2:39660366-39660388 GTGTTTACATGGATGGAGTAGGG + Intergenic
929814929 2:45223101-45223123 GTATTTATTGAGATGGAGTTTGG - Intergenic
931057191 2:58485821-58485843 GAGTTTATAGACAAGGAGTAGGG + Intergenic
931146828 2:59528298-59528320 GGGATTATAGGCATGGAGCATGG + Intergenic
931391919 2:61851778-61851800 GGGTGTATAGGGATGGTGCAGGG + Intronic
932575492 2:72960275-72960297 GTGCTTAATGAGATGGAGCCAGG - Intronic
934032058 2:88056638-88056660 TTTTTTATAGAGATTGGGCAGGG + Intergenic
938309781 2:130281697-130281719 TTGTTTGTAGGGATGAAGCAGGG - Intergenic
940014886 2:149093530-149093552 ATGTTTAAAGAGATGGCCCATGG - Intronic
941203783 2:162546669-162546691 ATGTTTATAGCTTTGGAGCAGGG + Intronic
943129546 2:183839151-183839173 GGGTTTCTAGAGAGGGATCATGG + Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
944725438 2:202466773-202466795 GTGTTTGTAGAGATGTGGTATGG + Intronic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
948491444 2:238315648-238315670 GTTTTTATAGGGGAGGAGCATGG - Intergenic
948629692 2:239294186-239294208 GAGTTGATAGAGGTGGATCATGG - Intronic
1171843348 20:30242246-30242268 CTGTTTATGGAGATGTAGCTAGG - Intergenic
1172813508 20:37668654-37668676 GTGCTTATAAAGATGGAATAAGG + Intergenic
1174776170 20:53345189-53345211 GTTTTTGTGGATATGGAGCAGGG + Intronic
1174826959 20:53777111-53777133 GTTTTTGTAGAGATGGAGTCTGG - Intergenic
1178285683 21:31323515-31323537 TTTTTTATAGAGATGGTGCCAGG - Intronic
1178592558 21:33923828-33923850 GTGTTGATAGAAATGGACAATGG + Intergenic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1180695758 22:17750496-17750518 ATGTTTATAGAGAGAGAGAATGG + Intronic
1180700521 22:17779055-17779077 GTGTTGGTGGGGATGGAGCAGGG - Intergenic
1181447540 22:22989399-22989421 TTGGTTATAGAGATGGAGTAGGG - Intergenic
1182951932 22:34384298-34384320 CTCTTTATAGAGAGGAAGCAAGG - Intergenic
1183585799 22:38752329-38752351 GTGCTCATACACATGGAGCAAGG + Intronic
1185405291 22:50644740-50644762 GAGTTTATAGCCAAGGAGCAGGG - Intergenic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
950383519 3:12637509-12637531 ATGTTAATAGAGATGGAGGCGGG - Intronic
950403202 3:12787017-12787039 GTGATTATAGGGTTGGAACAGGG + Intergenic
955536349 3:59927901-59927923 GTGTTCAAAGAGATGGTGGAAGG - Intronic
956618662 3:71198702-71198724 TTTTTTTTTGAGATGGAGCACGG + Intronic
957608735 3:82439717-82439739 GTGTACAGAGAGATAGAGCAGGG + Intergenic
959842487 3:110994341-110994363 GAGTTTATAGCCAAGGAGCAAGG + Intergenic
962336639 3:134537740-134537762 GTGACCATAGGGATGGAGCAAGG - Intronic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
964891387 3:161540307-161540329 GTGTATATGGGGATGGAGCCAGG + Intergenic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
965689930 3:171344958-171344980 GTGTTGATAGTGTTGGAGCCTGG - Intronic
965893679 3:173546349-173546371 GTGATTATATAGATGGTTCACGG - Intronic
967776226 3:193388810-193388832 GTGGTTACAAAGATGGAGAATGG + Intergenic
971173431 4:24257681-24257703 GTGTTTGCAGACATGGGGCAGGG - Intergenic
971176060 4:24283781-24283803 GTGTGTACAGAGCTGAAGCAAGG - Intergenic
971532524 4:27706942-27706964 GTATTGATAGGGATGGAGCCAGG - Intergenic
971619162 4:28831576-28831598 GTGATAATAGAGATGGAGAGGGG - Intergenic
976745812 4:88402017-88402039 GTGATTATAGTGATGAACCATGG + Intronic
979264088 4:118681694-118681716 GTGGTTATAGAAATGAAGAATGG + Intergenic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
980530940 4:134053339-134053361 TTGTTTACTGAGATAGAGCAAGG + Intergenic
984041153 4:174735570-174735592 TTATTTTTTGAGATGGAGCATGG + Intronic
984261379 4:177446556-177446578 ATGCTTATAAAGATGGTGCATGG + Intergenic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
984652504 4:182285807-182285829 ATGTTTTCAGAGATGGACCAAGG + Intronic
986289599 5:6389090-6389112 GTCTTCAGTGAGATGGAGCAGGG + Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988292371 5:29304866-29304888 TTGTGTATAGAGATGGAGTCAGG + Intergenic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
992355265 5:75975410-75975432 ATGTCTATAGACATGGAGCAAGG - Intergenic
992903818 5:81325514-81325536 GTGATTATAATGATGGACCACGG + Intergenic
995139989 5:108725122-108725144 GAATTTATAGAGAAGGAGCAGGG + Intergenic
995865094 5:116681853-116681875 GTGTTTTCAGACATGGGGCAAGG + Intergenic
996560741 5:124826276-124826298 GTGATGAGAGAGATGGAGTATGG + Intergenic
998065752 5:139156977-139156999 CTGTGTATAGAAAAGGAGCAAGG - Intronic
998815011 5:146004987-146005009 GTGTTTATATAAATGGATAAAGG + Intronic
1000845171 5:166270571-166270593 GTGCTTATAGGCATGGATCAAGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001868320 5:175125538-175125560 GTGTTTCCAGAGAGGAAGCAGGG + Intergenic
1003863140 6:10340191-10340213 GTGTTTTAAGAGATCGAGAAAGG - Intergenic
1006567292 6:34970826-34970848 TTTTTTATAGAGATGGGGCCTGG - Intronic
1006813964 6:36838743-36838765 TTGTTGATAGAGATGAAGGAAGG + Intronic
1007041527 6:38726759-38726781 GTGAGTAAAGAGATGGAACAAGG + Intronic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1008626143 6:53318559-53318581 GTTTTTGTAGAGATGGGGCGGGG - Intronic
1011063925 6:83303018-83303040 ATGGTTATAGAAATGGATCAAGG + Intronic
1012448161 6:99327858-99327880 GTGTTTATAGAGTTGGAGAAAGG - Intronic
1014249311 6:119099483-119099505 GGTCTTATTGAGATGGAGCAGGG - Intronic
1014358985 6:120451778-120451800 GTGTTTACAGAGATGTAGCAAGG + Intergenic
1015376546 6:132516460-132516482 CTGATTCTAGAGCTGGAGCAGGG - Intergenic
1016308900 6:142712688-142712710 GTGTTCATAGAGTTGTGGCAAGG + Intergenic
1016646977 6:146421865-146421887 TTGTTTATAGGAATGGAGAATGG - Intronic
1019536023 7:1530451-1530473 ATGTTTATAGAGACAGAGAATGG + Intergenic
1020806730 7:12799237-12799259 AGGTGTATAGAGATAGAGCAGGG - Intergenic
1020999493 7:15310970-15310992 GTGTTTTTAGAAATGGAAGAGGG - Intronic
1022179009 7:27899911-27899933 GTGTTCAGGGAGCTGGAGCATGG + Intronic
1023434122 7:40124826-40124848 TTTTTTATAGAGATGGGGCTTGG - Intergenic
1023707778 7:42960194-42960216 GTGTTTACAGAGAGAAAGCAGGG + Intergenic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1025275539 7:57579035-57579057 GTGTTTCTATAGATGGAGAGGGG - Intergenic
1026100893 7:67383861-67383883 TTGTTTATTGAGATGGAGTTTGG + Intergenic
1026609369 7:71844032-71844054 GCATTTATAGAGATGGACCCTGG + Intronic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1030405940 7:109113679-109113701 GTGATTATAGAAATGGAACATGG + Intergenic
1032748640 7:134813855-134813877 GTGTTTAGAGTGATGAATCAGGG + Intronic
1033110632 7:138571492-138571514 GTGATTATGGTGATGGATCATGG + Intronic
1034211749 7:149369762-149369784 GTATTTATAGCCAAGGAGCAGGG - Intergenic
1037218053 8:16482431-16482453 GTGGTTATAGAAATGGACTAGGG - Intronic
1039094869 8:33872687-33872709 GTGCTTATAGGGATGGGCCACGG - Intergenic
1040799991 8:51329856-51329878 ATGTTTATGGAGATTGAGAAGGG + Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1045560386 8:103256073-103256095 CTGTTTATAGAGTTAGAGCCAGG - Intergenic
1048556039 8:135477253-135477275 GTGTTTACTGATATGTAGCAGGG + Intronic
1050120521 9:2302730-2302752 GAGCCTATAGAGCTGGAGCAAGG - Intergenic
1051423245 9:16909584-16909606 GTGTTTGTGGGGATGGAGGAAGG + Intergenic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1053169105 9:35865772-35865794 GGGATTATAGAGGTGGAGGAGGG - Intergenic
1053186150 9:36018125-36018147 GTTTTTGTAGAGATGGAGTGGGG - Intergenic
1053237309 9:36467679-36467701 TTGTGTATAGAGATGATGCATGG - Intronic
1054723148 9:68623703-68623725 GTGGTGATAGAGATGGAGAAAGG + Intergenic
1056084858 9:83137161-83137183 GTGTTTAAAGAGATGAAAGAAGG - Intergenic
1056454080 9:86743618-86743640 GTGTTTAAAGTCATGGACCAGGG - Intergenic
1057294627 9:93827925-93827947 GTGTTTATAGGGATGTGGAACGG + Intergenic
1057744885 9:97742932-97742954 CTGCTTACAGAGATGCAGCAAGG - Intergenic
1057829475 9:98395778-98395800 GTGGTTAGAAGGATGGAGCAAGG + Intronic
1061469833 9:130815713-130815735 GTGTTTATTTAGAAGGAGCTGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188330765 X:28868498-28868520 ATGGTTATAGAAATGGAGAAGGG - Intronic
1191959351 X:66682992-66683014 GTACTTATAGAGCTGGAGTAAGG + Intergenic
1191970492 X:66809868-66809890 GAGTTTAAGGAGATGAAGCAAGG - Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1193699410 X:84743571-84743593 GTGTGTATAGGGATGGTGTATGG - Intergenic
1194638894 X:96378421-96378443 GTGTGTTTTGAGATGAAGCAGGG - Intergenic
1196059149 X:111388997-111389019 GTTTTGATAGATCTGGAGCATGG + Intronic
1197343263 X:125300211-125300233 GTATTTATACAGATGCTGCAGGG + Intergenic
1197788273 X:130222836-130222858 GTATTTTTAGAGATGGGGCAGGG + Intronic
1198081388 X:133243172-133243194 CTTTTTAAAGAGATGGAGCCAGG - Intergenic
1199207928 X:145170966-145170988 CAGCTTATAGAGAGGGAGCAAGG + Intergenic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1201674875 Y:16569912-16569934 GTGGTTACGGAGCTGGAGCAGGG + Intergenic