ID: 1140866289

View in Genome Browser
Species Human (GRCh38)
Location 16:79065443-79065465
Sequence GGAAAATGGTCCTCGTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140866289 Original CRISPR GGAAAATGGTCCTCGTGCAC TGG Intronic
904305504 1:29586092-29586114 GGAAAATGACCCTGGGGCACTGG + Intergenic
916169735 1:161992909-161992931 GGAAAATGGTGCTGGTAGACTGG + Intronic
916263394 1:162865447-162865469 GATAAATGTTCCTTGTGCACTGG - Intronic
920337150 1:205252561-205252583 GGAAAATGGTCATCTTTCAGAGG - Intronic
924669053 1:246104704-246104726 GGAAATTGGTTCTGGTACACTGG - Intronic
1065056482 10:21848691-21848713 GGAGAATGTTCCATGTGCACTGG - Intronic
1071049781 10:81432356-81432378 GGAAAATGGTACACCTGCCCTGG - Intergenic
1074224622 10:111472510-111472532 TGATGATGGTCCTCTTGCACAGG + Intergenic
1075654741 10:124153377-124153399 GGGAAACGGTGCTCGTGCCCAGG + Intergenic
1089395049 11:118131267-118131289 GGAAAATGGCCCTGGTGCATAGG - Intergenic
1089583078 11:119493673-119493695 GGAAAATGGTCATCTTGTAAAGG + Intergenic
1091156376 11:133377850-133377872 GGAAAATGGCCCTGGAGCATGGG + Intronic
1101720275 12:107345004-107345026 GGAAAATGGTTATCTTCCACTGG - Intronic
1105917838 13:24933442-24933464 GGAAAAAAGTCATAGTGCACAGG + Intergenic
1107764951 13:43724525-43724547 GTAAAATGGTCCTTGTGCATAGG - Intronic
1115618963 14:35122185-35122207 GGAAAATGGTTCTCCTTCAGAGG + Exonic
1117654376 14:57939442-57939464 GGCCAATGCCCCTCGTGCACTGG - Intronic
1120267490 14:82269728-82269750 GGAAGCTGGTCCTTGTGCAGTGG + Intergenic
1122131938 14:99609360-99609382 GGAAGATAGTCCTGGTGCAGAGG - Intergenic
1138845186 16:60556414-60556436 GGAAAATGGGCTTCATGCAATGG - Intergenic
1139094458 16:63687894-63687916 GGAGAATGTTCTTTGTGCACTGG - Intergenic
1140478023 16:75248693-75248715 GGAACGTGGGCCCCGTGCACAGG - Intronic
1140866289 16:79065443-79065465 GGAAAATGGTCCTCGTGCACTGG + Intronic
1144825414 17:18103032-18103054 ACAAAATGGTCCTTGTGCTCAGG - Intronic
1147543975 17:41384727-41384749 GGACAATGTTCCGCATGCACTGG + Intronic
1149333756 17:55612886-55612908 GAAAAATGCTCCTCTTGGACTGG - Intergenic
1149554436 17:57563257-57563279 GAAAAATGGTCCACGTGGATGGG - Intronic
1152026356 17:77811959-77811981 GGCAGATGGTCTTCGTGCATGGG - Intergenic
1159460371 18:68715289-68715311 GGAAAACGGTGCTGGTTCACTGG + Exonic
1160251656 18:77208749-77208771 GGAAAATGTCCCTCATGGACGGG - Intergenic
1164496898 19:28773876-28773898 GGAATATGCTCCTAGTCCACTGG + Intergenic
925608424 2:5682945-5682967 GGGAAATGGGCCTGGTGCAGTGG - Intergenic
927344033 2:22015821-22015843 GAAAAATGGTCCTTCTCCACAGG - Intergenic
928675635 2:33648318-33648340 GGAAAATGGTCCTCATGCACTGG - Intergenic
935343267 2:102077777-102077799 GGAAAATAGTCCACATGCAGTGG - Intronic
936484017 2:112911248-112911270 GGTAGGTGGTCCTCCTGCACTGG + Intergenic
937146642 2:119651684-119651706 GGTAAATGTTCCATGTGCACTGG + Intronic
938207605 2:129437527-129437549 GGAACATGGTCCCTGTGCTCAGG + Intergenic
1175339393 20:58218603-58218625 GGCAGATGGTCCTCCTCCACCGG - Exonic
1177281126 21:18984441-18984463 GGAAAATGGTCCTTGTGTCCTGG - Intergenic
1179159495 21:38881316-38881338 GGCAAATGTTCCATGTGCACTGG + Intergenic
1182783374 22:32885846-32885868 GGAATATGGGCCTGGTGCAGTGG - Intronic
952162019 3:30703407-30703429 GGAAAATAGTCCTTGTGTGCTGG - Intergenic
953084694 3:39655176-39655198 GGGAAATGATCCTAGTGAACAGG + Intergenic
953202781 3:40792397-40792419 GTAAACTGGTGCTCATGCACAGG + Intergenic
958652107 3:96949876-96949898 GGAAAATGGTGCTGGTCCTCAGG - Intronic
965183686 3:165436312-165436334 GGAAAATAGTCCTCTTGCACTGG - Intergenic
966384306 3:179379223-179379245 GGAAAATGCTGTTGGTGCACTGG - Intronic
968030277 3:195477842-195477864 GGAAAATGGTTCAGGTGCATTGG + Intergenic
970501010 4:16677163-16677185 GGAAAATAGTCATGGGGCACTGG + Intronic
978884215 4:113746711-113746733 GGTAAATAGTCCTCGTTGACAGG + Intronic
979114181 4:116800146-116800168 GGAAAATGGTCCTCAGGCAGAGG - Intergenic
981429458 4:144643561-144643583 GAAAAATGGTCCTCTTTCATTGG - Intergenic
986237320 5:5924102-5924124 GGCAAATGGTCTTGGTTCACTGG + Intergenic
987918399 5:24247149-24247171 GGATAATGGTCCTCTTGCTTAGG - Intergenic
991466271 5:66915718-66915740 GGACACAGGTCCTCCTGCACTGG + Intronic
991466283 5:66915773-66915795 GGACACAGGTCCTCCTGCACTGG + Intronic
991516925 5:67447335-67447357 GGAAAATGTTCCATGTGCACTGG + Intergenic
992262744 5:74987275-74987297 GGAGAATGGTCCTGGTGCTGTGG - Intergenic
992793978 5:80239056-80239078 GGAAACAGGTCCTGGAGCACAGG - Intronic
993352595 5:86868433-86868455 GAAAAACAGTCCTCCTGCACTGG + Intergenic
1000839557 5:166200441-166200463 GGCAAATGTTCCATGTGCACTGG + Intergenic
1006170616 6:32089866-32089888 GGAAAAGGCTCCTCATGCCCAGG - Intronic
1012988607 6:105901305-105901327 GGAAAATGGTCATGATGTACTGG - Intergenic
1014436956 6:121431463-121431485 GGAAAATATTACTTGTGCACTGG - Intergenic
1018372577 6:163181551-163181573 GGAAATGGGTCCTCATGGACAGG + Intronic
1018428821 6:163707607-163707629 GCAAAGTGGTGCTCGTGCACAGG + Intergenic
1021489459 7:21202864-21202886 GGAAAATGATTCTGGTGTACAGG + Intergenic
1021760405 7:23897971-23897993 AGAAAATAGGCCTGGTGCACTGG + Intergenic
1030014623 7:105206247-105206269 AGAAAATGCTACTAGTGCACTGG - Intronic
1035833304 8:2722091-2722113 GGGAAATGGGTCTCGTGCTCCGG + Intergenic
1039227245 8:35401722-35401744 GGAATATGAACCTGGTGCACAGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041140129 8:54808706-54808728 GAAAAATGTTACTCCTGCACGGG + Intergenic
1042488766 8:69376000-69376022 TGAAAATGGTCTTCCTGCACTGG + Intergenic
1052666954 9:31507604-31507626 GGAAAAGAATCCTCGTACACTGG - Intergenic
1056146433 9:83735247-83735269 GGAAAATGTTCCATATGCACTGG + Intergenic
1056992954 9:91427504-91427526 AGAAAATGGTCCTGGCACACAGG - Intergenic
1059771362 9:117429569-117429591 GGAACATGGACCTCCTGCACTGG + Intergenic
1060602947 9:124890124-124890146 GGAAAGTGGTCCATGTCCACGGG - Intronic
1061746785 9:132745942-132745964 GTAAAATGATCCTGGTGCTCAGG + Intronic
1189967454 X:46389537-46389559 GGAAAATGGTCCTTGTTCACTGG - Intergenic
1192557758 X:72103879-72103901 GGAAACTGGTACTCGGGCACTGG - Intergenic