ID: 1140866561

View in Genome Browser
Species Human (GRCh38)
Location 16:79067457-79067479
Sequence GGAGCCGAGAAGAGCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140866561_1140866568 17 Left 1140866561 16:79067457-79067479 CCTGAGATGCTCTTCTCGGCTCC 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1140866568 16:79067497-79067519 TACCCTTTATAGTGTCTGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140866561 Original CRISPR GGAGCCGAGAAGAGCATCTC AGG (reversed) Intronic
900137827 1:1125883-1125905 GAAGCCCAGGAGAGCAGCTCGGG + Intergenic
900428971 1:2593103-2593125 TGAGCCTGGAAGAGCATCGCGGG + Intronic
900655166 1:3753233-3753255 GGAGCCGGGGTGACCATCTCGGG - Intronic
902811853 1:18892525-18892547 GGAGCTGGGAAGAGCATCCCAGG + Intronic
904593744 1:31629987-31630009 GAAGCCGAGCAGAGCATGGCAGG + Exonic
905491927 1:38351111-38351133 GGCGGGGAGAAGAGCATTTCAGG - Intergenic
908323232 1:62998510-62998532 GGAAGGGAGAAGAGCTTCTCAGG + Intergenic
908412595 1:63882060-63882082 GGAGCAGAAAATAGCATCACAGG + Intronic
912307359 1:108582840-108582862 GGAGCAGAGTAGAGCATATTTGG + Intronic
915701617 1:157802086-157802108 GGATCGGAGGAGAGCCTCTCAGG + Exonic
920674529 1:208029953-208029975 GGAGCTGGGAACATCATCTCAGG - Intronic
921416987 1:214899987-214900009 GGAGCAGAGATGAGCCTTTCTGG - Intergenic
923777661 1:236994529-236994551 GGAGCTGGGGAGAGGATCTCAGG + Intergenic
1062806447 10:423446-423468 AGAGCCCACAAGAACATCTCAGG - Intronic
1067440699 10:46307894-46307916 GGAGCAGAGAGGGACATCTCAGG - Intronic
1070874073 10:79784763-79784785 GGAGCCTGGAAGAGCAGCTGGGG - Intergenic
1071641007 10:87306902-87306924 GGAGCCTGGAAGAGCAGCTGGGG - Intergenic
1071654230 10:87431034-87431056 GGAGCCTGGAAGAGCAGCTGGGG + Intergenic
1071923665 10:90380107-90380129 GGAGAAGAGAACAGCATCCCAGG + Intergenic
1073358314 10:102874936-102874958 TGATCCTAGAAGAGCATCTGTGG + Intronic
1078197754 11:9150453-9150475 GGAGCATAGGAGAGTATCTCAGG - Intronic
1082801752 11:57420001-57420023 GGGGCAGAGAAGAGGATCTCTGG - Intronic
1083181184 11:60986716-60986738 GGAGCTGAGAAGAGCTTCTAGGG - Intronic
1083416314 11:62528073-62528095 GGGGCCTTGAAGTGCATCTCAGG + Exonic
1083416453 11:62528859-62528881 GGGGCCTTGAAGTGCATCTCAGG + Exonic
1083416692 11:62530455-62530477 GGGGCCTTGAAGTGCATCTCAGG + Exonic
1083416822 11:62531223-62531245 GGAGCTCTGAAGTGCATCTCAGG + Exonic
1084502084 11:69540790-69540812 GGAGAGGAGAAGAGCGTCCCAGG + Intergenic
1088893946 11:114064075-114064097 GCAGCCGAGTCCAGCATCTCAGG + Exonic
1091304068 11:134525648-134525670 GGAGCAGAGCAGAGCACCGCCGG + Intergenic
1091864521 12:3819964-3819986 GGATAGGAGAAGGGCATCTCAGG - Intronic
1092232259 12:6782792-6782814 GGAGCTGAGAAGACCACGTCAGG - Intergenic
1092959687 12:13584209-13584231 GGGGCAGAGAAGAGCATGTGAGG - Intronic
1094047098 12:26179171-26179193 AGAGGGGAGAAGAGCATCTCAGG + Intronic
1098314822 12:69182213-69182235 GGAGCCGGGGCGAGCACCTCTGG + Intergenic
1098484179 12:71001462-71001484 GAAGCCGAGAACAGCTTCCCAGG + Intergenic
1098588371 12:72182732-72182754 GAGGCTGAGAAGAGCATCTTTGG - Intronic
1098922619 12:76316225-76316247 GGAACAGAGAAGAGCGTCTTAGG + Intergenic
1101509255 12:105377967-105377989 GGAGCAGAGAAGAGAGTCTGGGG + Intronic
1101514248 12:105419752-105419774 GGAGCCCAGTAGAGCACCACAGG - Intergenic
1105957834 13:25301027-25301049 GGGGCCCAGAAGAGCGTCCCAGG - Intergenic
1114629694 14:24151155-24151177 AGAGCCGAGAAGATCTCCTCTGG - Exonic
1115420404 14:33187342-33187364 GGTGTGGAGAAGAGCATTTCAGG - Intronic
1119228523 14:72962173-72962195 TGAGACGAGAAGGGCTTCTCAGG + Intergenic
1120728287 14:87971317-87971339 GGAGCATAGAAGACCAACTCAGG + Intronic
1121536902 14:94697194-94697216 GTCGCCGAGGAGAGCATCTCTGG + Intergenic
1121848621 14:97197968-97197990 GGTACCAAGATGAGCATCTCAGG + Intergenic
1128379616 15:67102922-67102944 GGAGTCTAGGAGAGCATCCCAGG - Intronic
1130040693 15:80403875-80403897 GGAGCCGAGCAGCGCGGCTCTGG + Intergenic
1133202861 16:4215125-4215147 GGACCCGAGAAGAGAAATTCTGG + Intronic
1133519585 16:6544037-6544059 GACACCTAGAAGAGCATCTCAGG - Intronic
1137348245 16:47684956-47684978 GTTGGCGAGTAGAGCATCTCTGG + Intronic
1140797314 16:78451412-78451434 GGAGCTGAGAAGAGCATATTTGG + Intronic
1140866561 16:79067457-79067479 GGAGCCGAGAAGAGCATCTCAGG - Intronic
1143432203 17:6895416-6895438 GGAGCCTTGAAGAACACCTCAGG - Intronic
1145755350 17:27386169-27386191 AGAGCCCAGGAGAGAATCTCAGG - Intergenic
1146775748 17:35614133-35614155 GGGGCTGTCAAGAGCATCTCTGG - Intronic
1148795128 17:50193224-50193246 GGAGCCTGGAAGGGCATCTTGGG - Intronic
1152298295 17:79481037-79481059 GGAGCAGAGAAGAGCACCCATGG + Intronic
1156099588 18:33578238-33578260 GGGGCCGAGCGGAGCATCCCCGG + Intergenic
1160342482 18:78101721-78101743 GGAGGAGAAGAGAGCATCTCAGG - Intergenic
1160788688 19:913009-913031 GGAGGCGGGGAGAGGATCTCAGG + Intronic
1162792565 19:13070580-13070602 GGAGCTGAGCTGAGCATGTCAGG + Intronic
1167211049 19:48134302-48134324 GTAGCCGAGTAGAGAATCGCTGG - Intronic
1168077402 19:53988818-53988840 GGAGCTGGGCAGAGCATCCCTGG - Exonic
925289030 2:2734342-2734364 GGAGCAGAGACAAGCATCGCTGG + Intergenic
925920852 2:8636864-8636886 AGAGAGGAGGAGAGCATCTCAGG - Intergenic
927702683 2:25277791-25277813 GGAGCTGAGATGAGCTTTTCAGG + Intronic
928956059 2:36869128-36869150 GGAGCAGAGAAAAGCCTCACTGG - Intronic
929928720 2:46235812-46235834 GGAGCTGAGAAGAGCAGATGAGG - Intergenic
935897683 2:107755343-107755365 GGAGCCGAGAAGAGAAGCTGAGG - Intergenic
939014087 2:136881086-136881108 GGAGTTGGGAAGGGCATCTCAGG - Intronic
946188926 2:217996943-217996965 GGAGCCGGGAAGTGGATCTTGGG - Intronic
947224284 2:227825416-227825438 GGAGCCAAGAAGAGCAAATGGGG + Intergenic
1168768852 20:400994-401016 GGAGCAGAGAAGAGCCTTCCTGG - Intergenic
1170470063 20:16659906-16659928 GTAGCACAGAAGAGCATCTGTGG + Intergenic
1172101554 20:32486767-32486789 GGAGCCGAGGACATCATGTCTGG - Intronic
1173709024 20:45138484-45138506 GCAGCCGAGAAGGGCAGATCTGG + Intergenic
1174168895 20:48604237-48604259 AGGGCGGAGAAGAGCATCCCGGG + Intergenic
1175283442 20:57820782-57820804 GGGGTCGGGAAGAGCATCTTAGG + Intergenic
1175754630 20:61521738-61521760 GCAGCCTGGAAGAGCCTCTCAGG + Intronic
1177880886 21:26693396-26693418 AAAGCAGAGAAAAGCATCTCTGG + Intergenic
1179550932 21:42143325-42143347 GGAGGCCAGAAACGCATCTCTGG + Intronic
1180132112 21:45833562-45833584 GGAGGGGAGAAGGGCTTCTCAGG + Intronic
1181005674 22:20012367-20012389 GGGGCAGAGCAGAGCATCTGTGG + Intronic
1181172407 22:21017100-21017122 GGAGGCGAGAGGGGCATCTAGGG - Intronic
1181176964 22:21043403-21043425 GGAGGCGAGAGGGGCATCTAAGG + Intergenic
1181429051 22:22866654-22866676 GGAACTGAGGAGAGCATCCCTGG + Intronic
1182066099 22:27432773-27432795 GAAGCAGGGAAGAGCATCTTTGG - Intergenic
1183760038 22:39807635-39807657 TGAGGAGAGAAGAGAATCTCAGG - Intronic
949381070 3:3446718-3446740 GGAGAGGAGAGGAGCCTCTCTGG + Intergenic
950187102 3:10951984-10952006 GGAGCAGAGCAGAGCACCTGGGG + Intergenic
953679862 3:45030987-45031009 GGAGGCGAGAAGAGCATTGCTGG - Intronic
953946659 3:47154595-47154617 GGAGCAGAGAAGAGATACTCAGG + Intronic
954614318 3:51961791-51961813 GGAGCACAGAAGAGCAGCTGGGG + Intronic
960641674 3:119830669-119830691 GAAGTTCAGAAGAGCATCTCTGG - Intronic
962320967 3:134389781-134389803 GGTGCTGAGAACAGCAACTCAGG + Intergenic
963390047 3:144649822-144649844 AGAGTGGAGAAGAGCATTTCAGG - Intergenic
969972217 4:11059794-11059816 GGAGCAGCGAAGAGAATCACTGG + Intergenic
970649136 4:18158372-18158394 GGAGCAGAGAAGAGTTTCTATGG + Intergenic
971073286 4:23119569-23119591 GGTGGGGGGAAGAGCATCTCAGG + Intergenic
974684955 4:65215673-65215695 GGAGCCAAGAACAGGAACTCAGG - Intergenic
978744331 4:112174646-112174668 GGAGCCAAGAAGAGCCTTCCTGG + Intronic
982422602 4:155214564-155214586 GGCGAGGAGAAGAGCATCTATGG + Exonic
984514561 4:180721789-180721811 GGAGCCCAGCACAGCAGCTCAGG - Intergenic
984816047 4:183837147-183837169 GGAGTGGGGAAGAGCATCCCAGG + Intergenic
984855044 4:184187803-184187825 AGGGCCTAGAAGAGTATCTCTGG + Intronic
985523196 5:388732-388754 TGGGCCCTGAAGAGCATCTCGGG + Intronic
985809816 5:2074727-2074749 AGGCCCGGGAAGAGCATCTCAGG - Intergenic
985887210 5:2688905-2688927 GGAGCCAGGAAAAGCTTCTCAGG + Intergenic
988180112 5:27780127-27780149 GGAGCACAAAAGAGTATCTCTGG + Intergenic
988717076 5:33838754-33838776 GGAGCAGAGAAGAGGACCTGGGG + Intronic
990594600 5:57300256-57300278 TGAGCCCAGAAGTGCATCTCTGG + Intergenic
990727158 5:58768658-58768680 GGAGATGGGAGGAGCATCTCAGG + Intronic
992743323 5:79795415-79795437 GGAGGCGTGAAGATCATCTCAGG + Intronic
994002031 5:94791976-94791998 GGAGCCCCGAAGACCATCCCAGG + Intronic
998516308 5:142757707-142757729 CGAGCTGAGAAGAGTATCTGTGG + Intergenic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1007331270 6:41111359-41111381 GGGGCAGAGAGGAGCTTCTCAGG + Intergenic
1012581978 6:100880941-100880963 GGAGGCAGGAAGAGAATCTCTGG + Intronic
1018637596 6:165877479-165877501 GGAAGCGAGAAGAGAATTTCGGG - Intronic
1019355257 7:575326-575348 GGCCCCAAGAAGAGCATCCCGGG + Intronic
1019923144 7:4175378-4175400 GGAGCCGAGCAAACCACCTCAGG - Intronic
1025958766 7:66202839-66202861 GGAGCCGGGCAGATCATCTGAGG + Intergenic
1028705925 7:93846189-93846211 GAAGCAGAGAAGAGGATCACTGG + Intronic
1032082343 7:128865998-128866020 GGATCAGAGAAGACCAGCTCTGG + Intronic
1032155311 7:129463058-129463080 GCAGCAGAGAAGGGCAGCTCTGG - Intronic
1033425286 7:141238595-141238617 GGAACCCAGAAGACCATCTCTGG + Intronic
1035181213 7:157090772-157090794 GGCCCTGAGAACAGCATCTCAGG + Intergenic
1035340475 7:158157570-158157592 GGAGCCGAGCAGTGCAGGTCCGG + Intronic
1036670040 8:10777450-10777472 GGTGCCGAGGACAGAATCTCTGG - Intronic
1045327697 8:101128855-101128877 GGAGCTGAGAAGTGGAGCTCTGG + Intergenic
1051598338 9:18847661-18847683 AGAGAGGAGAAGAGCATCCCAGG + Intronic
1053309127 9:37004476-37004498 GAAGCCGTGAAGGGCTTCTCAGG - Intronic
1056185246 9:84128408-84128430 GGAGGTGAGGAGAGAATCTCAGG - Intergenic
1057028663 9:91756676-91756698 GGAGCCCAGAAGACAATCCCAGG - Intronic
1057551739 9:96056133-96056155 GGACCTGAGATGAGCCTCTCTGG + Intergenic
1057578754 9:96266762-96266784 GGAGTGGAGAAGGGCATCTGGGG - Intronic
1058152236 9:101476068-101476090 GGTGCCGGGAAGAGCATGGCTGG + Exonic
1059363789 9:113769710-113769732 AGTGCCAAGAAGAGCATCTGGGG - Intergenic
1187528975 X:20079558-20079580 GGAGCCAAGAAGAAGCTCTCAGG - Intronic
1188734040 X:33690340-33690362 GGAGCAGAGAAGAGATTCTCAGG - Intergenic
1191868191 X:65722861-65722883 GGATTCAAGAAGAGAATCTCTGG + Intronic
1192182196 X:68923047-68923069 GGAGCAAAGAAGAGCCTTTCAGG - Intergenic
1193699222 X:84742448-84742470 GCAGCAGAGAACAGAATCTCAGG + Intergenic
1194348175 X:92792833-92792855 GGTGGTAAGAAGAGCATCTCTGG + Intergenic
1195982092 X:110590375-110590397 GGAGCCCTGAAAATCATCTCTGG - Intergenic
1200247948 X:154535824-154535846 GGAGAGGAGGAGAGCATCCCGGG + Intronic
1200656504 Y:5909462-5909484 GGTGGTAAGAAGAGCATCTCTGG + Intergenic