ID: 1140868282

View in Genome Browser
Species Human (GRCh38)
Location 16:79083299-79083321
Sequence GGTCAGGGTGAACCACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140868282_1140868288 2 Left 1140868282 16:79083299-79083321 CCAGTGTGTGGTTCACCCTGACC 0: 1
1: 0
2: 1
3: 13
4: 122
Right 1140868288 16:79083324-79083346 TTCCTATGCCCCAGCAATTAAGG 0: 1
1: 0
2: 0
3: 14
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140868282 Original CRISPR GGTCAGGGTGAACCACACAC TGG (reversed) Intronic
900090679 1:919092-919114 AGTCAGTGAAAACCACACACGGG - Intergenic
900590875 1:3459272-3459294 GGCCAGGGAGAACCACACACCGG + Intronic
901031181 1:6307846-6307868 GGGCAGAGGGAACCACAAACAGG + Intronic
901031193 1:6307906-6307928 GGGCAGAGGGAACCACAAACAGG + Intronic
905990535 1:42334447-42334469 GGGCAGGATGCAACACACACAGG + Intronic
908327453 1:63037124-63037146 GGGCAGGGAACACCACACACTGG - Intergenic
909702310 1:78540181-78540203 GAGCATGGTGAATCACACACAGG + Intergenic
910278871 1:85476463-85476485 GGTCAGGCTGAACAACACTGAGG - Intronic
910825600 1:91404437-91404459 GCTCAGGGGGCGCCACACACCGG + Intronic
910843321 1:91582377-91582399 GGTGAGGGTAAACCTGACACAGG - Intergenic
915682288 1:157593054-157593076 GGGCAGGGAGCATCACACACTGG + Intronic
917313495 1:173701637-173701659 GGGCAGGGTACACCACACACCGG + Intergenic
919324071 1:196083257-196083279 TGTAAGGGCGAACTACACACTGG + Intergenic
920306542 1:205021816-205021838 TGACTGGGTGAACCACACACAGG - Exonic
921127248 1:212188789-212188811 ATGCAGGGTGAACCACATACAGG + Intergenic
922843306 1:228662649-228662671 GGGCAGGGAACACCACACACTGG + Intergenic
1064585761 10:16837933-16837955 GATCAGGGTGGACCACTCAGCGG - Intronic
1065496098 10:26329985-26330007 GGGAAGGGAGAAACACACACTGG + Intergenic
1067326416 10:45271759-45271781 GGGCAGGGAAAATCACACACTGG + Intergenic
1072133650 10:92521991-92522013 GGGCAGGGTGATGCACACATAGG + Intronic
1075389705 10:122083614-122083636 GTTCAGGGTCACCCACAGACAGG + Exonic
1076599617 10:131648347-131648369 GGTCTGTGTGAACCACGCAGTGG + Intergenic
1076701373 10:132275036-132275058 GGACACCGTGAACCACACACTGG - Intronic
1077114966 11:879985-880007 GGGGAGGGTGCAGCACACACAGG + Intronic
1077173062 11:1176889-1176911 GGTCAGGCTAGAGCACACACAGG - Intronic
1080894265 11:36436055-36436077 GGTCAGGGTGAAATTCACAGGGG - Intronic
1084479391 11:69409925-69409947 GGTCTGGTTGAAGCACACAGTGG - Intergenic
1085328396 11:75626355-75626377 GGTAAGGAGGGACCACACACTGG + Intronic
1085820616 11:79789394-79789416 GGGCAGGGAACACCACACACTGG - Intergenic
1089316632 11:117595727-117595749 ACTCAGGGTGACCCACACAAAGG - Intronic
1099511507 12:83544554-83544576 GGTCAGGGAACATCACACACCGG - Intergenic
1102002793 12:109568132-109568154 GGTCATGGTGAAGCTCACATTGG - Intronic
1102816517 12:115870385-115870407 GGTCAAAGTGACCCACAAACAGG + Intergenic
1103995987 12:124830533-124830555 TGACAGGGTAAATCACACACAGG + Intronic
1104642543 12:130476594-130476616 GGTTAGGGAGCAGCACACACAGG - Intronic
1104860299 12:131919934-131919956 GCTCAGGGTGCAGCAGACACGGG - Intronic
1107727222 13:43311051-43311073 GGGGAGGGGGCACCACACACAGG + Intronic
1115996096 14:39197455-39197477 GGTAAGGATGGACCACACAAAGG + Intergenic
1119853906 14:77885317-77885339 GAGCAGGGAGAACCAGACACTGG + Intronic
1121865798 14:97361395-97361417 AGCAAGGGTGAACCACACCCAGG - Intergenic
1122465097 14:101928049-101928071 GGTCAGGGCCGCCCACACACAGG + Intergenic
1122769374 14:104091229-104091251 GCTCAGGGTCCACCCCACACCGG - Intronic
1202904216 14_GL000194v1_random:59306-59328 GCTCAGGGTGAACAAGACAGAGG + Intergenic
1127677340 15:61253883-61253905 CGTGGGGGTGAACAACACACTGG + Intergenic
1128144717 15:65326533-65326555 GGTCAGTCTGATCCTCACACAGG - Intergenic
1130208670 15:81902383-81902405 GGGCATGGTGATTCACACACTGG - Intergenic
1134034170 16:11016952-11016974 GGTGAGAGTGAACCTCACATAGG + Intronic
1135738604 16:24954335-24954357 GGTCAGGGTGTACCACAATCAGG + Intronic
1135812499 16:25601353-25601375 GGTCAGGGAACATCACACACTGG - Intergenic
1135944104 16:26849921-26849943 GGTTGGGGGGAACAACACACTGG + Intergenic
1136685304 16:31990498-31990520 GGTCAGGGTGCGGCACAGACTGG - Intergenic
1136883856 16:33919771-33919793 GGTCAGGGTGCGGCACAGACTGG + Intergenic
1138107586 16:54297489-54297511 GGGCACGGTGTACCACAGACTGG + Intergenic
1140868282 16:79083299-79083321 GGTCAGGGTGAACCACACACTGG - Intronic
1141338360 16:83178861-83178883 GGGGAGAGTGAACCAAACACTGG - Intronic
1141484394 16:84329237-84329259 GGTCAGGGTGAACCACTGCAGGG - Intronic
1142953678 17:3505511-3505533 GGGAATGGTGAACCACATACAGG + Intronic
1143020547 17:3915215-3915237 GGACAAGATGCACCACACACAGG + Intronic
1144217342 17:13068053-13068075 GCTCAGGATGCACCAAACACGGG - Intergenic
1146142112 17:30377430-30377452 GGCCATGGAGAACCACAGACGGG - Intergenic
1146226979 17:31075407-31075429 GATCAGGCTGAATCACAGACTGG + Intergenic
1147040034 17:37711370-37711392 GGGCAGGCAGCACCACACACAGG + Intronic
1147146251 17:38486177-38486199 GGTCAGGGTGAGGCACGGACTGG - Intronic
1148188536 17:45662121-45662143 GGTGAGGGTGAAGCTCCCACTGG + Intergenic
1148634958 17:49141937-49141959 TTTCAGGGTAAACTACACACTGG + Intronic
1149638595 17:58189349-58189371 GGTCAGGGCCAACCACATGCAGG - Intergenic
1151747026 17:76017259-76017281 GCTCAGAGTGAAACCCACACCGG - Intronic
1152711014 17:81870686-81870708 GGTCAGGGAGCAGCACACCCGGG + Intronic
1157158525 18:45290628-45290650 TGTAAGTGTGAAACACACACTGG + Intronic
1157718172 18:49903592-49903614 GGTCAGGGTGGAGCACACCCTGG - Intronic
1158600001 18:58848671-58848693 AGTAATGGTGAACCAGACACAGG + Intergenic
1160663089 19:310393-310415 GGCCAGGGTGAAATACGCACTGG + Intronic
1164160149 19:22620925-22620947 GGTCAAGGGGAACCAGACCCAGG - Intergenic
1167308872 19:48724789-48724811 GGTCAGGGTGCAGCTCGCACTGG + Exonic
1168515476 19:57007367-57007389 AGTCATGGTGAACCACTGACAGG + Intergenic
925257440 2:2502282-2502304 GGCCAGAGTGCACCACATACAGG - Intergenic
925672639 2:6327659-6327681 GGGCAGGGAGCATCACACACTGG - Intergenic
925878078 2:8328790-8328812 TGTCAGGGTGCTCCACCCACAGG - Intergenic
929824178 2:45297158-45297180 GGTAAGGGTAAAATACACACTGG + Intergenic
931307124 2:61040554-61040576 GGGCAGGGAGCATCACACACTGG + Intronic
932700161 2:73986097-73986119 GGTGAGGGTGAAGAACCCACCGG + Intergenic
936805881 2:116331968-116331990 GGGCAGGGAGCATCACACACTGG - Intergenic
938975613 2:136474631-136474653 GGTCGGGGAGTATCACACACTGG + Intergenic
940291171 2:152078924-152078946 AGACATGGTGGACCACACACTGG - Intronic
940473795 2:154134025-154134047 GTACATGGAGAACCACACACGGG + Intronic
942015418 2:171808877-171808899 GGGCAGGGAGCATCACACACTGG - Intronic
943359081 2:186896251-186896273 GGGCAGGGAAAATCACACACTGG - Intergenic
947073716 2:226319077-226319099 AGTCTGGGGGGACCACACACAGG + Intergenic
1175195813 20:57242550-57242572 TGTTAGGGTGAACCCCATACAGG - Intronic
1175240623 20:57545634-57545656 GGTCAGAGCGAGCCACTCACAGG - Intergenic
1175958775 20:62624534-62624556 GGCCAGGGTGCACTGCACACTGG - Intergenic
1176623587 21:9074073-9074095 GCTCAGGGTGAACAAGACAGAGG + Intergenic
1177949945 21:27522462-27522484 GGGCAGGGAGCATCACACACTGG + Intergenic
1180611371 22:17100372-17100394 GGTCAGGGTCAACCACAAAGTGG - Exonic
1185086791 22:48745260-48745282 GCTCAGGGTGAACCCCGGACAGG - Intronic
1185086842 22:48745486-48745508 GCTCAGGGTGAACCCCGGACAGG - Intronic
1185086854 22:48745542-48745564 GCTCAGGGTGAACCCCGGACAGG - Intronic
951468561 3:23030589-23030611 GGGCAGGGTACATCACACACCGG - Intergenic
953018372 3:39098826-39098848 GGGCAGGCTGGGCCACACACTGG + Exonic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961601042 3:128062283-128062305 GGGCAGGGAGAGCCACACAGAGG + Intronic
966841296 3:184090382-184090404 AATCTGGGTGAAGCACACACAGG - Intergenic
967882509 3:194311925-194311947 GGTCAGGATAAACCTTACACAGG - Intergenic
967947763 3:194817762-194817784 GGTCAGGATGTACCTCAGACAGG + Intergenic
969044999 4:4330280-4330302 GGTCAGGGTGAGGCCCCCACAGG + Intergenic
969396998 4:6928336-6928358 TGCCAGGGTGAACCAGACACAGG - Intronic
976760588 4:88544869-88544891 GGGCAGGGAGCATCACACACTGG + Intronic
978204774 4:106068324-106068346 GGGCAGGGAGCACCACACACTGG - Intronic
980696517 4:136363497-136363519 GGGCAGGGAGCATCACACACTGG + Intergenic
985345120 4:188996533-188996555 TGGCAGGGTGCAACACACACTGG - Intergenic
988471191 5:31540407-31540429 GGTCAGGAGGCACCACACAAGGG - Intronic
992825087 5:80541288-80541310 GGTCAGGGTGAAAAGCACAATGG - Intronic
999329497 5:150662857-150662879 GGGCAGGGTGAACCAGAGACTGG + Intronic
999615572 5:153419263-153419285 GGGCAGGGAGCATCACACACTGG - Intergenic
1000676617 5:164129840-164129862 AGGCAGGGTGATCCAGACACGGG - Intergenic
1003644974 6:7907439-7907461 GTTCAGGGTGACTCACAAACTGG + Intronic
1005985424 6:30870786-30870808 AGTCATGGAGAACCACACACTGG + Intergenic
1016197518 6:141363673-141363695 GGTGAGGGCTTACCACACACAGG - Intergenic
1017236026 6:152118566-152118588 GGGAAGGGAGCACCACACACTGG + Intronic
1024055299 7:45656666-45656688 GGTGAAGGTGAACCAGACACAGG + Intronic
1024096411 7:45986286-45986308 GGTCAGTGTCAGCCACTCACAGG - Intergenic
1024621198 7:51159000-51159022 AGACAGGGTGTCCCACACACTGG - Intronic
1027221041 7:76214136-76214158 GGACAGGGTGAACCACAGCATGG - Intronic
1028398947 7:90403975-90403997 GGTCTGGGTCTACCACACACAGG + Intronic
1032063512 7:128745762-128745784 GCTCTGGGTGAACAACACTCTGG - Intronic
1038547958 8:28440549-28440571 GGTGGGGGGGAACCACACACAGG - Intronic
1038910590 8:31959445-31959467 GGTGATGCTGAACCACAGACAGG - Intronic
1049104126 8:140600820-140600842 GGTCTTGGTGACCCACTCACTGG - Intronic
1050163881 9:2744684-2744706 GGTTAGTGTGTACCACCCACTGG - Intronic
1051607098 9:18926879-18926901 GGTCTGGGTGAGCCTCACAGAGG - Intergenic
1059993950 9:119891513-119891535 GGTCAGAATCAAGCACACACAGG - Intergenic
1203746771 Un_GL000218v1:44501-44523 GCTCAGGGTGAACAAGACAGAGG + Intergenic
1203563335 Un_KI270744v1:74979-75001 GCTCAGGGTGAACAAGACAGAGG - Intergenic
1189215126 X:39316524-39316546 GGGCAGGGAACACCACACACCGG + Intergenic
1189341218 X:40206046-40206068 GGACAGGGTGTGCCTCACACAGG + Intergenic
1201160099 Y:11159515-11159537 GCTCAGGGTGAACAAGACAGAGG + Intergenic
1201274986 Y:12288119-12288141 GGTCAGGGTGACCCTAACAGGGG + Intergenic