ID: 1140869883

View in Genome Browser
Species Human (GRCh38)
Location 16:79096537-79096559
Sequence CTAGAGAAGGCTTCCTCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140869883 Original CRISPR CTAGAGAAGGCTTCCTCCGA AGG (reversed) Intronic
902915390 1:19635789-19635811 CTAGAGAAGGCTTGCTGGGCCGG - Intronic
903293704 1:22330439-22330461 CTTCAGAAGGCATCCTTCGAAGG - Intergenic
904943785 1:34184090-34184112 TTAGGGAAGTCTTCCTCTGAGGG + Intronic
905618027 1:39414340-39414362 CTAGAGGAGGCTTCCTCCACTGG + Exonic
906290374 1:44615724-44615746 GCAAAGAAGGCTTCCTCAGAAGG + Intronic
907359411 1:53902717-53902739 TTACAGAAGGCTTCCACCCAGGG + Intronic
913055771 1:115158251-115158273 ATAGTGAAGGCTACCTCCTATGG + Intergenic
913294498 1:117305602-117305624 CTATAGTAGGCTTCCTCAGATGG - Intergenic
920514594 1:206575296-206575318 CTGGAGATGGCTTCCTTCCAAGG + Intronic
924753282 1:246917754-246917776 CTAAAGAAGGCTTTCTCTTATGG - Intronic
1063828612 10:9927006-9927028 ATAAATAAGGCTTCCTCCTAAGG + Intergenic
1064643889 10:17440748-17440770 ATGGAGAAGGCTTCCTCCCAAGG - Intronic
1070568187 10:77619844-77619866 GTAGAGAAGGCTTCCCAGGAAGG + Intronic
1071894677 10:90052751-90052773 AGAGAGAAGGCTTCCTCAGAGGG - Intergenic
1071952075 10:90714779-90714801 TTAGAGAAGGCTTCCAGCAAAGG - Intergenic
1072093768 10:92156184-92156206 CTGGAGAAGGCTTCCTGGAAAGG + Intronic
1074039459 10:109773742-109773764 CTAGAGAAGGCGTTCTGGGAAGG - Intergenic
1075003896 10:118817083-118817105 CTGGAGGAGGCTTCCCCTGAGGG - Intergenic
1076072084 10:127498128-127498150 CTAGCGGAGGCTTCCACGGAGGG + Intergenic
1078778118 11:14412100-14412122 CTGCAGCAGGCTTCCTCCCAAGG + Intergenic
1083191544 11:61055932-61055954 CTAGATAACACTTCCTCCAAGGG + Intergenic
1087242211 11:95791695-95791717 CTAGAGAAGGTTTCCTAGAAGGG + Intronic
1099890836 12:88586597-88586619 CTAGTAAAGGCTTCCTATGAGGG + Intergenic
1101567199 12:105919290-105919312 CTTGAGATGGCTTCCTCACAAGG - Intergenic
1101594566 12:106152608-106152630 TCTGAAAAGGCTTCCTCCGATGG - Intergenic
1102559236 12:113750260-113750282 CTAGAGAAGCCTTCCTCAAGTGG - Intergenic
1103884952 12:124193418-124193440 TTGGAGAAGGCTTCCTAAGAAGG + Intronic
1104023788 12:125011598-125011620 CTAAGGAAGGGTTCCTCCGGAGG + Intronic
1104674992 12:130706481-130706503 CCAGTGAAGGCTGCTTCCGAGGG + Intronic
1108546296 13:51498606-51498628 CCAGGGAAGGCTTCCTCAGAAGG + Intergenic
1112497635 13:99917307-99917329 CTAGAGAAGGGTCCCTCCCGGGG + Intergenic
1127995655 15:64151963-64151985 CTCGACAAGGTTTCCCCCGACGG - Intronic
1128578607 15:68793034-68793056 TTGGAGAAGGCTTCCTGGGAAGG - Intronic
1129226280 15:74172333-74172355 CAAGAGAGGGCTTCCTCTGCAGG + Intergenic
1134086134 16:11358703-11358725 CTGGTGAAGGCTTCCTCTGGTGG + Intergenic
1137387442 16:48054852-48054874 CTGGAGAAGGCTTCCAAGGATGG - Intergenic
1137879428 16:52031210-52031232 TCAGAGAAGGCTTCCTGCTATGG - Intronic
1138553964 16:57761625-57761647 CTGGAGAAGGCTTCCTGGGTTGG - Intronic
1140166540 16:72558295-72558317 CTGGAGAAAGCTTCCTTCTATGG + Intergenic
1140869883 16:79096537-79096559 CTAGAGAAGGCTTCCTCCGAAGG - Intronic
1141144075 16:81516567-81516589 GCAGGGAAGGCTTCCTCTGACGG - Intronic
1143594069 17:7903709-7903731 CTAGAGAAGGCTTTTTCCCCGGG - Intronic
1147394281 17:40129483-40129505 CTTGAGAAGGCTTTCTCCTTGGG - Exonic
1150641771 17:66954168-66954190 CTTTAGAAGGCTTCCTGGGAGGG - Intergenic
1155266030 18:24094481-24094503 ATAGACATGGCTTCCTCTGATGG - Intronic
1157045870 18:44100728-44100750 CTAGGGAAGGCTTCCTACCAGGG - Intergenic
1161290278 19:3490454-3490476 CCAGACATGGCTTCCTCCGCCGG - Intergenic
1163839688 19:19599325-19599347 ACAGAGCAGGCTTCATCCGATGG + Exonic
1164888697 19:31804794-31804816 CAAGACAAGGCTTCCTCCCCGGG + Intergenic
929005712 2:37390985-37391007 CTAGACATTGCTTCCTCCTAAGG + Intergenic
929928172 2:46232138-46232160 TTAGGGAAGGCTTCCTGGGAGGG - Intergenic
931429343 2:62196522-62196544 CTAGGGACGGCTTCCTCCACCGG - Intronic
934729492 2:96647678-96647700 CTAGAGACGGTTTCCTCCCAGGG - Intergenic
947083008 2:226419731-226419753 CTAGAGAAGTCTTCCCCATATGG - Intergenic
1168840376 20:906256-906278 CTCCAGATGGCTTCCTCCCAAGG - Intronic
1171806754 20:29687952-29687974 CTTGAGCAGACTTCCACCGAGGG - Intergenic
1171937402 20:31287966-31287988 CTATAGAAGGCTTCCTCCCAAGG - Intergenic
1174415051 20:50360782-50360804 CTGGAGGAGGCTTCATCTGACGG + Intergenic
1176685090 21:9839676-9839698 CTTGAGCCGACTTCCTCCGAGGG + Intergenic
1181491236 22:23262157-23262179 CTAAAGCAGGCTTCCTCCGCTGG + Intronic
950965069 3:17140287-17140309 CCCCAGAAGGCTTTCTCCGAAGG - Intergenic
955891140 3:63651392-63651414 CTAGAGATGGCTTCCTCAGAAGG - Intergenic
961718125 3:128872893-128872915 CCAGAGCAATCTTCCTCCGAAGG - Intergenic
962160122 3:132990020-132990042 ATAGAGCAGGCTTCCTCCAAGGG - Intergenic
963096674 3:141549422-141549444 CTAGAGAAGTCTGCCTTCAAAGG - Intronic
964704712 3:159605840-159605862 CTAGAGCAGTCTACCTCCTAAGG + Intronic
967203892 3:187101812-187101834 CAAGAGAACACTTCCTCTGAAGG + Intergenic
967953296 3:194857349-194857371 CTAGAGTGGGCTCCCTCAGATGG - Intergenic
971703237 4:30007584-30007606 ACAGAGAAGGCTTCCTCCACTGG + Intergenic
972183492 4:36498950-36498972 TTAGAGAAGGGCTCTTCCGAAGG - Intergenic
984697234 4:182791337-182791359 TTAGAGGAAGCTTCCTCAGAGGG + Intronic
985345999 4:189004903-189004925 CTAGATAATGATTCCTCTGATGG + Intergenic
985952661 5:3235603-3235625 CTAGAAAAGACTTTCTCCCACGG + Intergenic
993037915 5:82777467-82777489 CCAAAGAAGGCTTCCTCTCAGGG + Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
996919320 5:128749224-128749246 CTTGAGAAGCCTTACTCCGTAGG - Intronic
997428277 5:133819295-133819317 GAAGGGAAGGCTTCCTCCCAAGG - Intergenic
1000161524 5:158602297-158602319 CTAGAGAAGGGTAACTCCCAGGG + Intergenic
1000210796 5:159104708-159104730 CCAGAGAAGGCCTCCTCTGCTGG + Intergenic
1001321911 5:170689582-170689604 CCAGAGAAGGCTTCCAAAGAAGG + Intronic
1002189818 5:177472664-177472686 CTCCAGAGGGCTTCCTCCCAGGG + Intronic
1006154857 6:32008502-32008524 GCAGAGAAGGCTTCCTCCAGCGG + Intergenic
1006161170 6:32041237-32041259 GCAGAGAAGGCTTCCTCCAGCGG + Exonic
1017648700 6:156562296-156562318 CCAGGGAAGGCTTCCTCCTGTGG + Intergenic
1018719679 6:166563238-166563260 ATGGAGAAGGCATCCTCCGGTGG + Intronic
1020124125 7:5523320-5523342 CTTGAGTAGGCTTCCCCAGAGGG - Intergenic
1027270476 7:76515900-76515922 CTAGAGAAGGCATCTCCCCAAGG - Intronic
1028608165 7:92678942-92678964 GTAGAGCAGGCTTCCTGAGATGG - Intronic
1038849992 8:31266347-31266369 CTAGTAAAGTCTTCCTCCTAAGG - Intergenic
1041422770 8:57687554-57687576 ATAGAGAAGGCTTTCTGTGAAGG - Intergenic
1042815630 8:72875153-72875175 GTAGCGGAGGCTTCCTCCCAAGG + Intronic
1042816872 8:72887618-72887640 CAGGAGAAGGCTTCCTTCCAAGG + Intronic
1044702092 8:94974320-94974342 CCAGACATGGCTTCCTGCGAGGG + Intronic
1048289409 8:133169114-133169136 TTAGAGAAGGATTCCTGCAAAGG + Intergenic
1053171900 9:35892992-35893014 CAGGACAAGTCTTCCTCCGATGG + Intergenic
1054447917 9:65386747-65386769 CTTGAGCCGACTTCCTCCGAGGG - Intergenic
1057436933 9:95048985-95049007 CTAGAGCAGGCTTCTCCCGGCGG - Intronic
1057740843 9:97710054-97710076 ATAGAGAAGGCTTCTACCGTGGG - Intergenic
1058263921 9:102873848-102873870 TTTGAGAAGGCTTCCTCACAGGG + Intergenic
1059473285 9:114523636-114523658 CAAGACAATGCTTCCTCTGAAGG + Intergenic
1061881561 9:133571604-133571626 CTAGACAGGGCTGCCTCCGTGGG - Intronic
1062433300 9:136535422-136535444 CTACAGAAGTCTCCCTCCCAGGG + Intronic
1187379160 X:18784836-18784858 CTAGTGAAGGGTTCCTTGGACGG + Intronic
1189288761 X:39870584-39870606 CTCAAGAAGGCTATCTCCGAAGG + Intergenic
1189496612 X:41514459-41514481 CTGGAGCAGGCGTCCTCCCACGG + Intergenic
1189948562 X:46204856-46204878 CTTAAGAAGGCTACCTCTGAAGG - Intergenic
1196327586 X:114425738-114425760 CTAGAAAAGGCTGCCTCCACGGG + Intergenic