ID: 1140872197

View in Genome Browser
Species Human (GRCh38)
Location 16:79117200-79117222
Sequence ACAATTTCACCGTGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26591
Summary {0: 1, 1: 8, 2: 196, 3: 2880, 4: 23506}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140872196_1140872197 15 Left 1140872196 16:79117162-79117184 CCACTAGGCTGGGCTATTTTTGT 0: 1
1: 0
2: 20
3: 238
4: 3371
Right 1140872197 16:79117200-79117222 ACAATTTCACCGTGTTGCCCAGG 0: 1
1: 8
2: 196
3: 2880
4: 23506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140872197 Original CRISPR ACAATTTCACCGTGTTGCCC AGG Intronic
Too many off-targets to display for this crispr