ID: 1140873558

View in Genome Browser
Species Human (GRCh38)
Location 16:79129025-79129047
Sequence CTGTGTCAGGACAATGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140873558_1140873561 29 Left 1140873558 16:79129025-79129047 CCAAGTTCATTGTCCTGACACAG 0: 1
1: 1
2: 2
3: 9
4: 144
Right 1140873561 16:79129077-79129099 TTGCAAGTATGGATCTTGATAGG 0: 1
1: 0
2: 0
3: 19
4: 129
1140873558_1140873560 18 Left 1140873558 16:79129025-79129047 CCAAGTTCATTGTCCTGACACAG 0: 1
1: 1
2: 2
3: 9
4: 144
Right 1140873560 16:79129066-79129088 ATGCTGAGAGTTTGCAAGTATGG 0: 1
1: 0
2: 1
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140873558 Original CRISPR CTGTGTCAGGACAATGAACT TGG (reversed) Intronic
904248973 1:29208988-29209010 CTGTAGCAGGACAAAGGACTGGG + Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
909410359 1:75343216-75343238 CTGTTGCAAGACAATAAACTTGG - Intronic
911463515 1:98221473-98221495 CTGTGTAATTACACTGAACTGGG - Intergenic
911512419 1:98824075-98824097 CTGGGGCAGGAGAATGAACCTGG - Intergenic
915338220 1:155160525-155160547 CTGTTTCAGTAAAATGAAATGGG - Intergenic
917690011 1:177459184-177459206 CTGTCTCAGGACAAGAAAGTTGG + Intergenic
919894371 1:201999831-201999853 CTCTGTCAGGAAAATACACTTGG + Intronic
921404010 1:214759025-214759047 TTGTGTCATGACAATGATCACGG + Intergenic
1062785682 10:262853-262875 CTGTCTCAGGACAAGGGATTTGG - Intergenic
1065256369 10:23873135-23873157 CAGTGTAAGGACAATAATCTGGG + Intronic
1065889412 10:30108357-30108379 TGGTGTCAGGAAAGTGAACTTGG + Intronic
1067799746 10:49350892-49350914 CTGTGTGGGCACAATGACCTTGG - Intergenic
1068765811 10:60762460-60762482 CTGTCTCAAGACAGTGAACTGGG - Intergenic
1071921002 10:90350252-90350274 CTGAGCCATGACAATGAACATGG - Intergenic
1072171536 10:92867553-92867575 CTCTGTCAGGTGAATGCACTGGG + Intronic
1076184667 10:128437031-128437053 ATGTGACAGAATAATGAACTAGG + Intergenic
1082699316 11:56408552-56408574 TTGTGACAGGACAGTGATCTTGG + Intergenic
1083316793 11:61820104-61820126 CTGAGTCAGGAGAATCACCTGGG + Intronic
1085391375 11:76184064-76184086 CTCTGTCAGGACAAGTAAATGGG - Intergenic
1085973340 11:81621419-81621441 TTGAATCAGGAAAATGAACTAGG + Intergenic
1088367972 11:109058735-109058757 CTTTCTCATGAAAATGAACTTGG + Intergenic
1088981928 11:114871789-114871811 GTGGGTCAGAACAATGAGCTGGG + Intergenic
1089082115 11:115785285-115785307 CTGTGTCAGGGCCAGGAAGTGGG + Intergenic
1098190830 12:67946642-67946664 TTGTGTCACCACAGTGAACTGGG + Intergenic
1100435549 12:94568197-94568219 CTGGGTTTGGACAATGAACATGG - Exonic
1100997366 12:100316849-100316871 CTTTGACACGACAAAGAACTGGG - Intronic
1103704893 12:122866078-122866100 CTGTAACAGGGCAATGAACTTGG + Exonic
1104738145 12:131152653-131152675 CTGTGTCTGGACAAGGAATGTGG - Intergenic
1108034603 13:46275870-46275892 ATGTTTCAGGACATTGACCTAGG - Intronic
1108136674 13:47370858-47370880 CTGCTTCAGGACATTGAGCTGGG + Intergenic
1108147473 13:47494754-47494776 CTGTGTGAGGAGAATGAAACAGG + Intergenic
1111211062 13:85080975-85080997 CTATGTCAGGAGTCTGAACTAGG - Intergenic
1113984934 13:114306497-114306519 CTGAGGCAGGAGAATGAACCTGG + Intergenic
1116062321 14:39939460-39939482 CTGTGTCAGGAGTATGGAATAGG + Intergenic
1122498454 14:102176825-102176847 CTGAGGCAGGAGAATGAACCCGG - Intronic
1124788407 15:32703406-32703428 TTGTGTCAAGACAATGACTTTGG - Intergenic
1129092715 15:73168280-73168302 CTGAGGCAGGAGAATCAACTGGG - Intronic
1134821707 16:17252371-17252393 GTGTTTCAGGGCAATGAACCAGG - Intronic
1140821200 16:78664950-78664972 CTGGTTCAATACAATGAACTTGG + Intronic
1140873558 16:79129025-79129047 CTGTGTCAGGACAATGAACTTGG - Intronic
1140933894 16:79653129-79653151 TTGGAGCAGGACAATGAACTGGG + Intergenic
1143302698 17:5922516-5922538 CTGTGTCAGGCCGATGAGCCTGG - Intronic
1144235498 17:13256820-13256842 CTCTGGCAGGAGAATGAAATTGG + Intergenic
1144645859 17:16972922-16972944 CTGTGGCAGGAGAATGAACCTGG + Intergenic
1146964196 17:37010917-37010939 ATGTGTCAGGACATTTAACAGGG - Intronic
1147247360 17:39131227-39131249 CTGTGTCAGGACCAAGATCGAGG + Intronic
1147869514 17:43577696-43577718 CTGTGGCAGGACAAAGAAGCTGG - Intronic
1149045709 17:52242743-52242765 ATCTATCAGGACAAGGAACTGGG - Intergenic
1151671868 17:75575316-75575338 CGGTGTCAGGAGAATCCACTTGG + Intergenic
1152278488 17:79371846-79371868 CTGTGTCACGACACTGAGATGGG + Intronic
1155137980 18:23015530-23015552 ATGTTTCAGGACAATGGTCTGGG - Intronic
1156291642 18:35753011-35753033 CTGTGACAGGACATTGTCCTGGG - Intergenic
1157482244 18:48062883-48062905 CTGTGCCAGGACAAGCATCTTGG - Intronic
1157609491 18:48947626-48947648 CAGGGTCAGCAAAATGAACTTGG - Intronic
1158594585 18:58804927-58804949 CTGTGGCAAGACACTGAAATAGG - Intergenic
1159346043 18:67205918-67205940 CTAGATCAGGACTATGAACTTGG + Intergenic
1159363748 18:67438657-67438679 CTGTGTGAGGACATCTAACTTGG - Intergenic
1160371328 18:78374063-78374085 CTGTGTCAGAGCATTGAGCTCGG + Intergenic
1161053838 19:2180083-2180105 CTGTGTTAGGCCAAGGACCTTGG + Intronic
1162738730 19:12761624-12761646 CTGAGGCAGGAGAATGAACCCGG - Intergenic
1163129510 19:15263841-15263863 CTGTGTCATCACGATGAGCTGGG - Intronic
925802558 2:7615469-7615491 CTGTGTGAGTAAAATGCACTAGG + Intergenic
926479470 2:13372641-13372663 CTATATCAGCACAATGATCTGGG - Intergenic
926835554 2:17015692-17015714 CTGTTTCAGGAGTTTGAACTTGG - Intergenic
929685415 2:44029806-44029828 CTCTGTAAGGAAAATGGACTGGG + Intergenic
929924210 2:46195834-46195856 CTTTCTCAGGACAATAAAGTAGG - Intergenic
930235539 2:48885479-48885501 CGATGTCAGTACATTGAACTTGG + Intergenic
930314626 2:49782526-49782548 CTTTGGCAAGACAATGAACAAGG - Intergenic
931932146 2:67150543-67150565 CTGAGGCAGGAGAATGAACCTGG + Intergenic
933337311 2:80974963-80974985 CTCTGTGAGGAAAATGAGCTTGG - Intergenic
936508614 2:113128028-113128050 CTCTGTCAGCACATTCAACTAGG - Intronic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
940350120 2:152675469-152675491 CTGAGGCAGGCCAATGAGCTAGG + Intronic
940442644 2:153736463-153736485 CTGTTTCAGAACAAAGATCTGGG + Intergenic
941443351 2:165566815-165566837 ACGTATCAGAACAATGAACTTGG + Intronic
942985378 2:182134552-182134574 CTATTTCAGGTCAAAGAACTTGG - Intergenic
943717866 2:191172251-191172273 ATGTATCAGGGCAATTAACTTGG - Intergenic
945320214 2:208412598-208412620 CTGTGTGAGGACACTGTACTGGG + Intronic
946618820 2:221539085-221539107 CTGTGTCAGGACCTTGAACTTGG - Intronic
946977847 2:225173533-225173555 CTGTGACAAGACAAATAACTGGG - Intergenic
946978054 2:225175149-225175171 CTGTGACAAGACAAATAACTGGG + Intergenic
946980476 2:225208573-225208595 CTGTGTCACTAAAATGAATTGGG - Intergenic
947393242 2:229661514-229661536 CTGACTAAGGACAATGATCTAGG - Intronic
1170415000 20:16130142-16130164 CTTTGTCAGTACAATGAATTAGG - Intergenic
1171277064 20:23866438-23866460 GTGTGTCAGGACAGAGAAGTGGG - Intergenic
1174662321 20:52224287-52224309 ATGTGCCAGCGCAATGAACTTGG - Intergenic
1178402464 21:32298646-32298668 CTGTGTGAGGACAGGGAGCTGGG - Intronic
1179111812 21:38453481-38453503 ATTTGAAAGGACAATGAACTGGG + Intronic
1179835427 21:44028748-44028770 CTGAGGCAGAACAGTGAACTGGG + Intronic
1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG + Intergenic
1184814903 22:46861969-46861991 TGGTGTCAGGACAGTGTACTGGG + Intronic
949160272 3:873769-873791 CTGTCTCAGGATAAAGATCTTGG + Intergenic
950021358 3:9789893-9789915 CTGGGTCGAGACCATGAACTTGG - Exonic
951025905 3:17829735-17829757 CTGAGCCAGGAGAATGAACCTGG - Intronic
951179508 3:19642625-19642647 CTATAGCAGGACAATGGACTGGG - Intergenic
952651454 3:35732242-35732264 CTTTGTCAGCACAATTGACTTGG + Intronic
953607715 3:44422673-44422695 CTGTGTCAACAAAATGAGCTTGG + Intergenic
953621190 3:44534393-44534415 CAGTCTCAGGCCAATGTACTCGG + Intergenic
957039869 3:75328553-75328575 CTGGGAGAGGACGATGAACTTGG + Intergenic
959466746 3:106697346-106697368 ATGTGTTAGGAAAAAGAACTGGG - Intergenic
961196628 3:125007259-125007281 CTGAGTCAGGACAGTAAACGTGG + Intronic
962972934 3:140421666-140421688 CTGTGTGAGCACAAAGAACATGG - Intronic
964154818 3:153572354-153572376 ATGTGTCAGGACAGAGAATTAGG - Intergenic
966055665 3:175685763-175685785 CTGTCCCAGGACAATGACATTGG + Intronic
966183990 3:177212137-177212159 CTGAGTGAGGGAAATGAACTGGG - Intergenic
969270384 4:6095585-6095607 CTGAGTCAGGACAATGACTCAGG - Intronic
969282405 4:6179537-6179559 TTGTGTCAGGGCAATGGGCTTGG - Intronic
970938484 4:21603236-21603258 CTGTGTCTGTAAAATGACCTTGG + Intronic
971067929 4:23055901-23055923 GTGTGCCAGGACAATGTGCTAGG + Intergenic
974596588 4:64020718-64020740 CTGTGTAGGGACAATGAACTAGG - Intergenic
977800187 4:101219033-101219055 ATGTGTCAAGACACTGAGCTAGG + Intronic
979044682 4:115848004-115848026 GTGTGTCAGTAAAATTAACTAGG + Intergenic
982248879 4:153384104-153384126 CAGTGTCAGGACAATGAACTTGG - Intronic
982308141 4:153955055-153955077 CTGTGTCAGCAGAATGAGTTGGG - Intergenic
984568985 4:181367466-181367488 CGTTGTCAGGAGGATGAACTAGG + Intergenic
988640683 5:33038017-33038039 ATGTGACTGGAGAATGAACTGGG + Intergenic
989034746 5:37158880-37158902 CTGAGGCAGGAGAATGAACCCGG - Intronic
991633890 5:68683792-68683814 CTGAGTCAGAAGAATGAAATCGG + Intergenic
999701806 5:154235095-154235117 CTGTGGAAGGACAAGGAACCTGG + Intronic
1000379563 5:160616449-160616471 CTGTGGAACGGCAATGAACTTGG + Intronic
1001324079 5:170707361-170707383 ATGTGTCAGGACAAGGAGCAAGG - Intronic
1003178243 6:3769966-3769988 TTGTGTCAGAAGAATGAAATCGG - Intergenic
1003609059 6:7591903-7591925 CTCTGTGAGGACTAGGAACTAGG - Intronic
1003609066 6:7591966-7591988 CTCTGTGAGGACTAGGAACTAGG - Intronic
1006416309 6:33906164-33906186 CTGCGCCAGGAGAATGAAGTCGG + Intergenic
1008239538 6:49092465-49092487 ATGTTTCAGGACATTGATCTAGG - Intergenic
1009696534 6:67112267-67112289 CTCTGTCAGGAAAACGAATTAGG + Intergenic
1010584751 6:77643927-77643949 CTGTGTCAAGGAAATGATCTGGG - Intergenic
1013763660 6:113549306-113549328 ATGTGTCATGACATTGATCTGGG + Intergenic
1015350810 6:132216186-132216208 CTGTGTCAGCTCAAAGTACTGGG + Intergenic
1015487856 6:133791777-133791799 CCATGTCAGGACAATCATCTGGG + Intergenic
1021063350 7:16141896-16141918 GTGTGTGAGGACAATGATCTGGG - Intronic
1022297595 7:29070631-29070653 CTGTGTCAGGACACTAAATGTGG - Intronic
1026540489 7:71275843-71275865 AAGAGTCAGGACAAAGAACTGGG - Intronic
1027972415 7:85102348-85102370 CTGTGTCAGGGCAAAGACCATGG + Intronic
1028005784 7:85565664-85565686 CTATATTAGGAAAATGAACTGGG + Intergenic
1031939174 7:127769112-127769134 GTGTATCAGGAGACTGAACTGGG + Intronic
1032267436 7:130379431-130379453 CTGTGTCAGGACCCCGACCTTGG - Intergenic
1036427325 8:8656907-8656929 CTGTCTCAAGACAGTGAGCTGGG - Intergenic
1036762300 8:11517793-11517815 CTGTGACAGGACCAAGAGCTTGG - Intronic
1040478511 8:47802574-47802596 CTGAGGCAGGAGAATGAACCTGG - Intronic
1041381858 8:57259977-57259999 CGGTGTGAGGGCAGTGAACTTGG + Intergenic
1044773202 8:95659440-95659462 TTCTCTCAGGAGAATGAACTTGG - Intergenic
1050298867 9:4236103-4236125 CTGTGTGAGAACAGTGAACTTGG - Intronic
1052416607 9:28186093-28186115 GTATGACAGGACAAGGAACTAGG - Intronic
1058643120 9:107106175-107106197 CTGTCCCAGGACAATTAACTTGG - Intergenic
1059213225 9:112534143-112534165 CTGTGTCATGACATAGAGCTTGG + Intronic
1060781023 9:126413014-126413036 ATTTGTCATGGCAATGAACTGGG - Intronic
1062514383 9:136925240-136925262 CTCTGTCAGGACTGTGAACCTGG - Intronic
1185949384 X:4414657-4414679 CTGTTTCAGGAAGATGAACAGGG + Intergenic
1186915687 X:14217515-14217537 CTATGTCTGGAGAAAGAACTGGG + Intergenic
1194693383 X:97014046-97014068 CTGTGTCATGAAAATAAACATGG - Intronic
1195823034 X:108968189-108968211 CTGTGTCAGGTCACTGTACTGGG - Intergenic
1195914596 X:109923808-109923830 CTGTGTCATCACCATGCACTAGG - Intergenic
1197408309 X:126083456-126083478 ATGTTTCAGGACATTGGACTGGG - Intergenic
1201061420 Y:10050083-10050105 CTGAGTTAAGACAATGAATTTGG + Intergenic