ID: 1140879772

View in Genome Browser
Species Human (GRCh38)
Location 16:79187569-79187591
Sequence CACGCCCAGCTGATTTTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 2, 2: 27, 3: 127, 4: 443}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140879763_1140879772 22 Left 1140879763 16:79187524-79187546 CCAAGTAGCTGGGACTACAGGCC 0: 1095
1: 78583
2: 164622
3: 156882
4: 105691
Right 1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG 0: 1
1: 2
2: 27
3: 127
4: 443
1140879762_1140879772 23 Left 1140879762 16:79187523-79187545 CCCAAGTAGCTGGGACTACAGGC 0: 29903
1: 154936
2: 253675
3: 221513
4: 364385
Right 1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG 0: 1
1: 2
2: 27
3: 127
4: 443
1140879764_1140879772 1 Left 1140879764 16:79187545-79187567 CCCCTCCACACCGCACACCGCCA 0: 1
1: 0
2: 2
3: 26
4: 339
Right 1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG 0: 1
1: 2
2: 27
3: 127
4: 443
1140879766_1140879772 -1 Left 1140879766 16:79187547-79187569 CCTCCACACCGCACACCGCCACC 0: 1
1: 0
2: 8
3: 58
4: 517
Right 1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG 0: 1
1: 2
2: 27
3: 127
4: 443
1140879760_1140879772 26 Left 1140879760 16:79187520-79187542 CCTCCCAAGTAGCTGGGACTACA 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
Right 1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG 0: 1
1: 2
2: 27
3: 127
4: 443
1140879765_1140879772 0 Left 1140879765 16:79187546-79187568 CCCTCCACACCGCACACCGCCAC 0: 1
1: 0
2: 3
3: 27
4: 323
Right 1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG 0: 1
1: 2
2: 27
3: 127
4: 443
1140879767_1140879772 -4 Left 1140879767 16:79187550-79187572 CCACACCGCACACCGCCACCACG 0: 1
1: 0
2: 0
3: 34
4: 248
Right 1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG 0: 1
1: 2
2: 27
3: 127
4: 443
1140879768_1140879772 -9 Left 1140879768 16:79187555-79187577 CCGCACACCGCCACCACGCCCAG 0: 1
1: 0
2: 5
3: 56
4: 585
Right 1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG 0: 1
1: 2
2: 27
3: 127
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140879772 Original CRISPR CACGCCCAGCTGATTTTTAG TGG Intronic
900588896 1:3450298-3450320 CATGCCCAGCTGATCCTTTGGGG + Intergenic
900699058 1:4032716-4032738 CAAGCCCTGCTGCTTGTTAGTGG + Intergenic
901282934 1:8053271-8053293 CACGCCTGGCTAATTTTTTGTGG - Intergenic
901596414 1:10389010-10389032 CACGCCCAGCTAATTTTGGGGGG + Intergenic
902029893 1:13414613-13414635 CACGCCCAGCTAATTTTTGTGGG + Intronic
902135409 1:14300791-14300813 TACGCCAAACTGATTTGTAGGGG - Intergenic
903424183 1:23241090-23241112 CATGCCCAGCTAATTTTTGTGGG - Intergenic
903783005 1:25834458-25834480 CACGCCCAGCTAATTTTTTTTGG - Exonic
903881948 1:26516550-26516572 GACGCCCAGCTAATTTTTGGTGG + Intergenic
904154358 1:28470537-28470559 CATGCCCGGCTAATTTTTGGGGG - Intronic
904711199 1:32431829-32431851 CATGCCCAGCTAATTTTTACAGG + Intergenic
905087941 1:35400356-35400378 CACGCCTGGCTAATTTTTATTGG + Intronic
906283994 1:44573959-44573981 CACGCCCAGCTCATATTTTTTGG - Intronic
906319043 1:44805505-44805527 CACACCAAGCTGATTCTCAGTGG + Exonic
906338676 1:44958201-44958223 CAAGCCCATTTGATTTTCAGGGG - Intronic
906359070 1:45137218-45137240 CATGCCCAGCTAATTTTTTTAGG + Intronic
906903860 1:49866889-49866911 CACGCCAAGAACATTTTTAGAGG - Intronic
907206454 1:52776060-52776082 CACGCCCGGCTAATTTTTTTGGG - Intronic
907254803 1:53170839-53170861 CACACCCAGCTAATTTTTGTGGG - Intergenic
907272999 1:53301572-53301594 CATGCCCAGCTAATTTTTTTTGG - Intronic
907411874 1:54288861-54288883 CACACCCAGCTGATTTTTTTTGG - Intronic
907463882 1:54622580-54622602 CATACCCAGCTAATTTTTTGTGG - Intronic
907497821 1:54856442-54856464 CACGCCCGGCTAATTTTTTTTGG - Intronic
907507750 1:54933658-54933680 CACGCCTGGCTAATTTTTTGTGG + Intergenic
908469578 1:64430624-64430646 CATGCCCAGCTAATTTTTGTGGG + Intergenic
910448510 1:87324016-87324038 CACGCCCAGCTAATTTTTTTTGG - Intergenic
910862256 1:91753231-91753253 CATGACCAGCTGATTTTTTTTGG - Intronic
911186696 1:94911610-94911632 CATGCCCAGCTAATTTTTGTGGG - Intronic
911442444 1:97944207-97944229 CACGCCCAGCTAATTTTTGTGGG + Intergenic
912398187 1:109365377-109365399 CATGCCCAGCTAATTTTGTGAGG + Intronic
912455706 1:109795583-109795605 CACGCCCGGCTAATTTTTTTTGG + Intergenic
912886975 1:113484879-113484901 CACGCCCAGCTAATTTTTTTTGG + Intronic
913113373 1:115675633-115675655 CATGCCTGGCTGATTTTTAGTGG - Intronic
913525074 1:119683488-119683510 CACGCCCAGCTAACTTTTTAAGG - Intronic
914687041 1:149989581-149989603 CATGCCCAGCTAATTTTTGTGGG - Intronic
914724808 1:150318629-150318651 CACGCCCGGCTAATTTTTTGTGG - Intergenic
915115560 1:153596938-153596960 CACGCCCGGCTAATTTTTGGGGG + Intergenic
915122671 1:153640613-153640635 CACGCCTGGCTTATTTTTGGTGG - Intronic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
915477885 1:156163873-156163895 CAGGCCCAGCTCATTTTTTTTGG - Intronic
916227365 1:162502017-162502039 CACACCCAGCTAATTTTTTGAGG - Intronic
916335357 1:163665055-163665077 CACCCACAGCTCATTTTTAATGG + Intergenic
916518417 1:165541557-165541579 CATGCCCAGCTAATTTTTTTTGG - Intergenic
916552171 1:165859668-165859690 CACACCCTGCTAATTTTTTGTGG - Intronic
917294130 1:173501665-173501687 CACGCCCAGCTAATTTTTGGTGG + Intronic
917530934 1:175834328-175834350 CAGGCCCAGCTGATTTATTTTGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918777662 1:188655858-188655880 CAGGCCCAGCTAATTTTTGTGGG + Intergenic
919911825 1:202115951-202115973 CACACCCAGCTAAATTTTAGTGG + Intergenic
920391687 1:205607460-205607482 CACGTCCAGCTAATTTTGGGAGG + Intronic
920655883 1:207874446-207874468 CACGCCCAGCTAATTTTTTGTGG - Intergenic
920982397 1:210850352-210850374 CACGCCCAGCTACTTTTTTTTGG - Intronic
921203958 1:212832173-212832195 CATGCCCAGCTAATTTTTGTGGG + Intronic
922320961 1:224486260-224486282 CATGCCCAGCTAATTTTTGTGGG + Intronic
922498302 1:226077970-226077992 CACGCCCAGCTAATTTTTGTGGG + Intergenic
922523515 1:226279002-226279024 CATGCCCTGCTAATTTTTTGTGG - Intronic
922708116 1:227802109-227802131 CACGCCCAGCTAACTTTTTTGGG + Intergenic
923250567 1:232176422-232176444 CACACCCAGCTAATTTTTAAAGG - Intergenic
923372149 1:233325517-233325539 CACGCCCAGCTAATTTTTTTTGG - Intergenic
923768816 1:236918988-236919010 CGTGCCCAGATGATTTTTACAGG + Intergenic
924763868 1:247013271-247013293 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1062865348 10:847681-847703 CAGGCCCAGCTAATTTTTTTTGG + Intronic
1063672668 10:8112061-8112083 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1063992533 10:11581927-11581949 CACGCCGGGCTAATTTTTGGTGG + Intronic
1064203611 10:13304353-13304375 CACGCTCAGCTAATTTTCTGGGG - Intergenic
1064577314 10:16759348-16759370 CACGCCATGCTGATTTTTGTAGG - Intronic
1064661538 10:17612763-17612785 CACGCCCGGCTAATTTTTTTTGG - Intronic
1064759324 10:18602217-18602239 CACACCCAGCTAATTTTTGTGGG + Intronic
1065069529 10:22008180-22008202 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1065374226 10:25020608-25020630 CACACCCAGCTAATTTTTGTAGG - Intronic
1065559571 10:26948836-26948858 CACGCCCAGCTAATTTTTTTGGG - Intergenic
1066207945 10:33208215-33208237 CACGCCGAGCTAATTTTTTGTGG + Intronic
1067379337 10:45758762-45758784 CATGCCCGGCTAATTTTTTGTGG + Intronic
1067887037 10:50099424-50099446 CATGCCCGGCTAATTTTTTGTGG + Intronic
1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG + Intergenic
1072070497 10:91910561-91910583 AACACCCAGCTAATTTTTAGTGG + Intergenic
1072153719 10:92704712-92704734 CATGCCTAGCTAATTTTTAGGGG - Intergenic
1072902902 10:99425289-99425311 CACTCCCAGCTAATCCTTAGTGG - Intronic
1073252649 10:102130889-102130911 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1074111338 10:110424800-110424822 CATGCCCAGTTGATTTTTATAGG + Intergenic
1074757953 10:116640888-116640910 CAGGCCTAGCAGACTTTTAGGGG + Intronic
1075253385 10:120903351-120903373 CACACCCAGCTAATTTTCAAGGG - Intronic
1076042706 10:127264815-127264837 CGTGCCCAGCTAATTTTTTGTGG + Intronic
1079051460 11:17164193-17164215 CACACCCAGCTAATTTTTTTGGG - Intronic
1080191882 11:29560267-29560289 CACGCCCAGCTACTTTTTTGGGG - Intergenic
1080566688 11:33516113-33516135 CACCTCCAGCTGATTGGTAGTGG - Intergenic
1081116094 11:39203395-39203417 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1081162249 11:39763656-39763678 CACGCCCGGCTTATTTTTTTTGG - Intergenic
1081163725 11:39784391-39784413 CACGCCCTGCTAATTTTTTTTGG + Intergenic
1081443632 11:43107981-43108003 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1081486671 11:43536036-43536058 CACGTCCAGCTAATTTTTTTTGG + Intergenic
1083907224 11:65680975-65680997 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1083942461 11:65903841-65903863 TACGCCCAGCTAATTTTTTTTGG + Intergenic
1084318907 11:68362532-68362554 CACACCCAGCTAATTTTTGGGGG - Intronic
1084365805 11:68697392-68697414 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1084615744 11:70234692-70234714 CACACCCAGCTAATTTTGATGGG + Intergenic
1084842965 11:71872569-71872591 CACGCCCAGCTATTTTTTTTTGG - Intronic
1085218777 11:74854891-74854913 CACACTCAGCTGATTTTTGTGGG - Intronic
1085288116 11:75377375-75377397 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1085927909 11:81044046-81044068 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1086083585 11:82931506-82931528 CATGCCCAGCTAATTTTTGTGGG + Intronic
1087758033 11:102074857-102074879 CACGTCCAGCTTATTTTGGGGGG + Intronic
1087818726 11:102687869-102687891 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1089514134 11:119020860-119020882 CACACCCAGCTAATTTTTTGTGG + Intronic
1090798167 11:130153335-130153357 CACGCCCAGCTAACTTTTTGGGG - Intergenic
1091079011 11:132648656-132648678 CATGCCCAGCTAATTTTTTCTGG + Intronic
1093406327 12:18809492-18809514 CACGCCCGGCTAATTTTTTGTGG + Intergenic
1094106691 12:26819912-26819934 CATGCCCAGCTAATTTTTTTGGG - Intronic
1094111957 12:26871296-26871318 TACGCCCAGCCCATTTTTACAGG - Intergenic
1094538750 12:31345307-31345329 CACGCCCAGCTAATTTTTCTGGG + Intergenic
1095207086 12:39450663-39450685 CATGCCCAGCTAATTTTTTAAGG + Intergenic
1095456908 12:42396881-42396903 CATGCCCAGCTAATTTTTTGTGG - Intronic
1095961536 12:47837880-47837902 CACTCCAGGCTGATTTTTTGGGG - Intergenic
1097306798 12:58078388-58078410 AAAGTCCAGCTGCTTTTTAGTGG - Intergenic
1097690868 12:62733409-62733431 CATACCCAGCTGATTTTTTTTGG + Intronic
1098044083 12:66382080-66382102 CATGCCCAGCTAATTTTGAGGGG - Intronic
1098414785 12:70220542-70220564 CATGCCCAGCTAATTTTTGTTGG + Intergenic
1098543951 12:71690304-71690326 CATGCCCAGCTAATTTTTTCTGG + Intronic
1098728467 12:74000156-74000178 CCCACCCAGCTCATTTTTACTGG - Intergenic
1100315232 12:93439319-93439341 CACACCCAGCTAATTTTTGTAGG - Intronic
1100534351 12:95492719-95492741 AACGCCCAGCTAATTTTTTTTGG + Intronic
1100551843 12:95653297-95653319 CACACCCAGCTAATTTTTTGTGG + Intergenic
1100662023 12:96709875-96709897 CACGCCCAGCTAATTTTTTGTGG + Intronic
1101471391 12:104999925-104999947 CACTCCCAGCAGATCTTCAGAGG - Intronic
1101485319 12:105151774-105151796 CCAGCCCAGCTCATTTTTATTGG + Intronic
1101911581 12:108863953-108863975 CATGCCCGGTTGATTTTTAAGGG + Intronic
1102286115 12:111658093-111658115 CACGCCCAGCTAATTTTAGTAGG + Intronic
1102944130 12:116970506-116970528 CTCTCCAAGCTGCTTTTTAGCGG + Intronic
1103501271 12:121404541-121404563 CACACCCAGCTAATTTTTTTTGG + Intronic
1103865812 12:124051166-124051188 CACGCCCAGCCAATTTTTGTGGG - Intronic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1105464049 13:20620720-20620742 CACGCCTGGCTAATTTTTTGTGG + Intronic
1105493010 13:20905754-20905776 CTCGCCTGGCTAATTTTTAGTGG - Intergenic
1107570740 13:41655378-41655400 CACGCCCAGCCAGTATTTAGAGG + Intronic
1109408854 13:61938181-61938203 CATGCCCAGCTAATTTTTGGGGG + Intergenic
1109739379 13:66532145-66532167 CATGTCCAGCTATTTTTTAGTGG + Intronic
1109988902 13:70027859-70027881 CATGCACAGTTAATTTTTAGAGG + Intronic
1111925484 13:94459031-94459053 CATGCCCAGCTAATTTGTAAAGG + Intronic
1112287672 13:98118441-98118463 CAAGCCCAGCTAATTTTTAGTGG + Intergenic
1112522130 13:100105683-100105705 CACACCCAGCTAATTTTTGTGGG - Intronic
1113537081 13:111076462-111076484 CACGCCCAGCTGCTTGTCAAGGG - Intergenic
1113840726 13:113359426-113359448 CATGCCCAGCTAATTTTTAAGGG - Intronic
1114176805 14:20329277-20329299 CAAGCCCATATGATTTTCAGGGG + Exonic
1114541469 14:23463285-23463307 CACGCCCAACTAATTTTTGTGGG - Intergenic
1115231286 14:31163444-31163466 CACGCCCAGCTAATTCTTTGGGG - Intronic
1115645899 14:35368245-35368267 CACTCCCAGCTGAGCTTTAGAGG + Intergenic
1116458884 14:45147904-45147926 CACGCCCGGCTTTTTTTTTGGGG - Intronic
1116742227 14:48770954-48770976 CATGCCCAGCTAATTTTTGTAGG - Intergenic
1116989677 14:51262162-51262184 CATGCCCAGCTAAATTTTGGGGG + Intergenic
1117151481 14:52892609-52892631 CACGTCCAGCTAATTTTTTTTGG + Intronic
1117421627 14:55552245-55552267 CACGCCCGGCTAACTTTTTGTGG + Intergenic
1117682257 14:58216279-58216301 CACACCCAGCTAATTTTTGGGGG + Intronic
1118123464 14:62872534-62872556 CACGCCCAGCTAATTTTTTTTGG - Intronic
1118358731 14:65037934-65037956 GACACCCAGCTAATTTTTACGGG + Intronic
1118432094 14:65729180-65729202 CATGCCCAGCTAATTTTTTATGG + Intronic
1118574683 14:67230413-67230435 CATACCCAGCTTATTTTTTGTGG - Intergenic
1119452048 14:74719983-74720005 CACGCCCGGCTAATTTTTTTTGG - Intronic
1121202278 14:92128324-92128346 CACGCCCAGCTAATTCTTTTTGG - Intronic
1121253671 14:92516647-92516669 CACTCCCAGCTGCTTCTCAGAGG - Intronic
1122521418 14:102346465-102346487 CATGCCTGGCTGATTTTTACAGG - Intronic
1123479303 15:20616224-20616246 CAGGGCCAGCTAATTCTTAGAGG - Intergenic
1123638710 15:22384161-22384183 CAGGGCCAGCTAATTCTTAGAGG + Intergenic
1123714886 15:23020427-23020449 CATGCCCGGCTAATTTTTTGGGG - Intronic
1124108596 15:26764971-26764993 CACACCCAGCTAACTTTTTGTGG - Intronic
1124158079 15:27245714-27245736 CATGCCCAGCTAATTTTTTGTGG - Intronic
1125653155 15:41333733-41333755 CACGCCCGGCTAATTTTTTAAGG - Intronic
1127269585 15:57388394-57388416 CACGCACTGGTGATTTGTAGAGG + Intronic
1128058100 15:64715650-64715672 CACGCCTGGCTAATTTTTGGTGG - Intergenic
1128064799 15:64757817-64757839 CACGCCTGGCTGATTTTTTGTGG - Intronic
1129083257 15:73060801-73060823 CATGCCCAGCTAATTTTTTTGGG + Intronic
1130138956 15:81207077-81207099 CACGCCTGGCTAATTTTTTGTGG - Intronic
1130284023 15:82540677-82540699 CTCCCCCATCTGATTTTTAATGG + Intronic
1131104604 15:89724043-89724065 CACGCCCAGCTATTTTTTTTTGG - Intronic
1132173516 15:99688598-99688620 CACGCCCGGCTAATTTTTTGTGG - Intronic
1132361480 15:101219921-101219943 CACGCCCGGCTAATTTTGTGAGG + Intronic
1132761373 16:1510109-1510131 CAGGCCCAGTGTATTTTTAGCGG - Exonic
1132812184 16:1805793-1805815 CACGCCCATCTGAGTCTAAGAGG - Intronic
1132824186 16:1894927-1894949 CACGCCCAGCTAATTGTTTTTGG + Intergenic
1132827099 16:1910566-1910588 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1133093965 16:3428221-3428243 CATGCCCAGCTAATTTTGTGGGG - Intronic
1133122983 16:3623050-3623072 CATGCCCAGCTAATTTTTTTGGG - Intronic
1133157793 16:3887978-3888000 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1134396677 16:13871464-13871486 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134440595 16:14297514-14297536 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134491212 16:14696831-14696853 CATGCCCAGCTAATTTTTTGTGG - Intergenic
1134496593 16:14735949-14735971 CATGCCCAGCTAATTTTTTGTGG - Intronic
1135169952 16:20175025-20175047 CACGCCCAGCTAATTTGTGTAGG - Intergenic
1135753267 16:25074065-25074087 CAAGCCCAGCTGACTGTGAGAGG + Intergenic
1135861856 16:26063538-26063560 CACACCTAGCTAATTTTTAATGG - Intronic
1136353265 16:29726116-29726138 CACGCCCAGCCTATATTTTGAGG + Intergenic
1136430016 16:30191608-30191630 CATGCCCAGCTAATTTTTGGGGG - Intergenic
1137416125 16:48282252-48282274 CATGCCCAGCTAATTTTTGTGGG - Intronic
1137582969 16:49645351-49645373 CAAGCCCAGCTAATTGGTAGTGG + Intronic
1138034141 16:53585870-53585892 CAGGCCCAGATGATTTTTTAGGG - Intergenic
1139508890 16:67415300-67415322 CACGCTCAGCTAATTTTTTAAGG - Intronic
1139519628 16:67473503-67473525 TACGCCCAACTAATTTTTTGTGG + Intronic
1139575496 16:67839401-67839423 CACACCCAGCTAATTTTTTTTGG - Intronic
1139626493 16:68193510-68193532 CACACCCAGCTAATTTTTGTAGG - Intronic
1139697684 16:68686809-68686831 CACACCCAGCTTATTTTTTTTGG - Intronic
1139806710 16:69571914-69571936 CACGCCCGGCTAATTTTTTTTGG + Intronic
1139821448 16:69724543-69724565 CACACCCAGCTAATTTTTTTTGG - Intronic
1140047362 16:71450560-71450582 CACACCCGGCTAATTTTTTGTGG - Intronic
1140816528 16:78626285-78626307 CACGCTCAGCTAATTTTTGCAGG + Intronic
1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG + Intronic
1141106389 16:81237219-81237241 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1141417729 16:83889514-83889536 CATGCCCAGCTAATTTTTATGGG + Intergenic
1141542513 16:84736943-84736965 CTCGCCCGGCTAATTTTTTGTGG + Intronic
1141862028 16:86723977-86723999 CACGCCCAGGTGATCTCAAGGGG - Intergenic
1142536236 17:619086-619108 CACGCCCAGCTAATATTTCCCGG + Intronic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1143819451 17:9547945-9547967 CACACCCAGCTAATTTTTGTGGG + Intronic
1144130032 17:12238024-12238046 CACGCCCAGCTAATTTTTGGGGG - Intergenic
1144526397 17:15994103-15994125 CATGCCCAGCTAATTTTTTTTGG + Intronic
1145915164 17:28569311-28569333 CACACCCAGCTGATTTGTTTTGG - Intronic
1146373200 17:32278004-32278026 CACACCCAGCTGATTTTTAAGGG - Intronic
1146407035 17:32547791-32547813 CACGCCCGGCTAATTTTTGTAGG - Intronic
1146999393 17:37350361-37350383 CACACCCAGCTAATTTTTTCTGG - Intronic
1147499465 17:40948848-40948870 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1148004709 17:44417369-44417391 CACATCCAGCTAATTTTTGGGGG + Intronic
1148009184 17:44461845-44461867 CAAGCCCAACTAATTTTTGGGGG + Intronic
1148910229 17:50938592-50938614 CACGCCTGGCTAATTTTTGGGGG + Intergenic
1149483079 17:57018962-57018984 CACGCCCGGCTAATATTTTGAGG + Intergenic
1149587703 17:57803890-57803912 CACGCCCAGCTAATTTTTTTGGG + Intergenic
1149674733 17:58449541-58449563 CACACCCAGCTAATTTTTGCAGG - Intronic
1149748010 17:59118107-59118129 AATGCCCAGCTAATTTTTTGTGG - Intronic
1149790770 17:59474917-59474939 CATGCCCAGCTAATTTTTCTGGG + Intergenic
1150093508 17:62351579-62351601 CACACCCAGCTAATTTTTGTGGG + Intergenic
1150555676 17:66252095-66252117 CATGCCCAGCTAATTTTTGTAGG - Intronic
1150743006 17:67794763-67794785 CCCGCCCAGCTGATTTTTTTTGG - Intergenic
1151088567 17:71409018-71409040 CACGCCCAGCTGATTTTCGGAGG - Intergenic
1151278915 17:73057105-73057127 CATGCCCAGTTAATTTTTTGTGG + Intronic
1151308305 17:73278124-73278146 CACGCCCAGCTAATTTTAAGCGG + Intergenic
1151447149 17:74174645-74174667 CACGCCCAGATGATTTTTTTTGG - Intergenic
1151731091 17:75911673-75911695 CACGCTCAGCTATTTTTTTGTGG + Intronic
1151735314 17:75936333-75936355 CAGGCCCAGCTAATTTTGGGGGG - Intronic
1152764853 17:82130793-82130815 CACGCCCAGCTCCTTTTTTTTGG + Intronic
1153763544 18:8354054-8354076 CACGCCCAGCTAATTTTTTGTGG - Intronic
1155142357 18:23054755-23054777 CACGCCCAGCTAATTTTTATGGG + Intergenic
1155202123 18:23526548-23526570 CCCGCCCCGCAGATGTTTAGGGG + Intronic
1155352483 18:24920070-24920092 CACACCCAGCTAATTTTGTGGGG - Intergenic
1155574940 18:27234399-27234421 AACACCCAGCTAATTTTTTGTGG + Intergenic
1155647413 18:28095651-28095673 CATGCACAGCTAATTTTTAGTGG - Intronic
1156243352 18:35274170-35274192 CATGCCCAGCTAATTTTTGGGGG + Intronic
1156614964 18:38772396-38772418 CACTCCCAGCTGCTTTTCACGGG + Intergenic
1157931856 18:51832302-51832324 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1158800941 18:60908016-60908038 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1158970159 18:62658774-62658796 CACACCCAGCTAATTTTTTGAGG - Intergenic
1159061243 18:63516611-63516633 CACTTCCAACTGATTTTGAGGGG - Intergenic
1159191028 18:65042894-65042916 CACGTCCAGCTAATTTTTTGGGG + Intergenic
1159347425 18:67225249-67225271 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1160348130 18:78151667-78151689 CAAGCCCCGCTGATTTCAAGTGG + Intergenic
1160456424 18:79005603-79005625 CACACCCTGCTAATTTTTTGGGG + Intergenic
1160882732 19:1329196-1329218 CATGCCCAGCTAATTTTTCTAGG - Intergenic
1161272308 19:3396797-3396819 CACACCCAGCTAATTTTTGTAGG - Intronic
1161477541 19:4494759-4494781 CACGCCCAGCTAATTTTTTAAGG - Intronic
1161529370 19:4778064-4778086 CACGCCTGGCTAATTTTTTGGGG + Intergenic
1162332080 19:10036444-10036466 CAAGCCCAACTGCTTCTTAGAGG + Intergenic
1162460943 19:10813667-10813689 CATGCCCAGCTAATTTTTTTTGG - Intronic
1162515943 19:11147723-11147745 CACACCCGGCTAATTTTTACAGG + Intronic
1162648480 19:12067041-12067063 CACACCCAGCTAATTTTTTATGG - Intronic
1162653226 19:12107618-12107640 CATGCCCAGCTAATTTTTGTGGG - Intronic
1162662528 19:12181627-12181649 CACGCCCAGCTAATTTTTTTTGG + Intronic
1162839908 19:13348849-13348871 CACACCCAGCTAATTTTGGGGGG - Intronic
1164256016 19:23528909-23528931 CAAGCCCAGCTAATTTTTTTAGG - Intronic
1164275788 19:23716672-23716694 CACGCCCAGTTAATTTTTTGTGG - Intergenic
1164309666 19:24034646-24034668 GACGCCCAGCTAATTTTTGCGGG + Intronic
1165429105 19:35762081-35762103 CAACCCCAGCTGACTTTTGGTGG + Exonic
1165430962 19:35772460-35772482 CAGGCCCAGCTAATTTTTAGTGG - Intergenic
1167434206 19:49469729-49469751 CATGCCCAGCTAATTGTTGGGGG + Intronic
1167750571 19:51377185-51377207 CACTCCCAGCTAATTTTTTGGGG - Intergenic
1167947428 19:52999984-53000006 CACATCCAGCTAATTTTTAGTGG - Intergenic
1167951378 19:53030452-53030474 CACGCCCAGCTAACTTTTGTGGG - Intergenic
1168045412 19:53790767-53790789 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1168223049 19:54974954-54974976 CAGGCCCGGCTAATTTTTTGTGG + Intronic
1168419859 19:56194443-56194465 CACGCCCGGCTAATTTTTATAGG + Intronic
1168624067 19:57902815-57902837 CATGCCCGGCTAATTTTTTGTGG + Intronic
925426153 2:3750414-3750436 CACGCCAAGAAAATTTTTAGAGG - Intronic
925733218 2:6937736-6937758 CACGGCCAGGTGATGTTTGGAGG + Intronic
925868868 2:8252175-8252197 CACGCCATGCTGCTTTTTATAGG - Intergenic
927034177 2:19155801-19155823 CAGGCCCAGCTAATTTTTCTAGG - Intergenic
927733959 2:25501534-25501556 CATGCCCAGCTAATTTTTGTTGG + Intronic
928508875 2:31983102-31983124 CACACCCAGCTAATTTTTGTGGG - Intronic
928989174 2:37213566-37213588 CATGCCCAGCTCATTTTTTGGGG + Intronic
930119185 2:47746126-47746148 CACACCTGGCTAATTTTTAGTGG - Intronic
931270006 2:60693275-60693297 CACGCCCGGCTAATTTTTTTTGG - Intergenic
931329665 2:61267597-61267619 TACACCCAGCTAATTTTTTGTGG + Intronic
931672889 2:64664823-64664845 CATGCCCAGCTAATTTTTATGGG + Intronic
933169994 2:79114527-79114549 CATGCCCAGCTAATTTTTGACGG + Intergenic
933712831 2:85340181-85340203 CATGCCCAGCTAATTTTTCTGGG + Intergenic
934866065 2:97812845-97812867 CATGCCCAGCTAATTTTGGGGGG - Intronic
935029527 2:99308866-99308888 CACGCCTGGCTAATTTTTAGTGG + Intronic
935159195 2:100514589-100514611 CATGCCTAGCTAATTTTTTGGGG + Intergenic
935632839 2:105226074-105226096 CACACCCAGCTAATTTTTGTGGG - Intergenic
935858624 2:107302659-107302681 CACACCCAGCTAATTTTTTTTGG - Intergenic
937108012 2:119337209-119337231 CATGCCCAGCTAGTTTTTTGGGG + Intronic
937386687 2:121440533-121440555 CATGCCCTGCTAATTTTTTGTGG - Intronic
937972630 2:127562451-127562473 CACGCCCAGCTAATTTTTGTGGG + Intronic
938272289 2:129983720-129983742 CACGCCCAGCTAATTTTTGTAGG - Intergenic
938909255 2:135870902-135870924 CATGCCCAGCTAATTTTTGTGGG + Intronic
940769454 2:157824908-157824930 CACGCCTGGCTAATTTTTGGTGG + Intronic
940882728 2:158962638-158962660 CACGCCCAGCTAATTTTTATTGG - Intergenic
942135527 2:172921251-172921273 CATGCCCAGCTAGTTTTTTGTGG + Intronic
942234966 2:173895137-173895159 CATGCCCAGCTAATTTCTTGGGG + Intergenic
942345438 2:174997841-174997863 CACACCCAGCTAATTTTTGTTGG - Intronic
944742237 2:202623843-202623865 CATGCCCGGCTAATTTTTAGTGG - Intergenic
944831763 2:203540135-203540157 CACGCCTGGCTAATTTTTTGTGG + Intergenic
945266782 2:207898599-207898621 CATGCCCAGCTAATTTTTGTGGG - Intronic
945949014 2:216021302-216021324 CACACCCAGCTAATATTTTGGGG + Intronic
945958408 2:216107470-216107492 CAAGCCCAGCTAATTTTTGTGGG - Exonic
946165494 2:217861135-217861157 AAAGCCCAGCTCATCTTTAGGGG + Intronic
946301263 2:218825489-218825511 CACGCCCAGCTAATTTTTGGGGG - Intronic
946854637 2:223940797-223940819 CATGCCCAGCTAATTTTTGTGGG + Intronic
946906609 2:224422846-224422868 CATGCCCAGCTAATTTTTTGGGG - Intergenic
947881342 2:233516529-233516551 CAGGCCCGGCTAATTTTTAGTGG - Intronic
948013896 2:234672241-234672263 CGCACCCAGCTGATTTTTTTAGG + Intergenic
948436865 2:237959728-237959750 TGCGCCCAGCTAATTTTTTGTGG - Intergenic
948900109 2:240952188-240952210 CATGCCCGGCTAATTTTTTGTGG - Intronic
1168862247 20:1053952-1053974 CACGCCCAGCTAATTTTGTATGG - Intergenic
1169043176 20:2512941-2512963 CACACCCAGCTATTTTTGAGGGG - Intronic
1169071400 20:2734250-2734272 CATGCCCAGCTAATTTTTGTAGG - Intronic
1169076705 20:2764443-2764465 CACACCCAGCTAATTTTTTAGGG + Intergenic
1169338528 20:4777222-4777244 CATGCCCAGCTAATTTTGGGGGG + Intergenic
1169396301 20:5233030-5233052 CACACCCAGCTTATTTTTTTTGG - Intergenic
1169489196 20:6056887-6056909 CACGCCTGGCTAATTTTTAGGGG + Intergenic
1169611329 20:7383326-7383348 CACTCCCATCTTACTTTTAGTGG + Intergenic
1169623230 20:7531748-7531770 TATGCCCTGGTGATTTTTAGAGG - Intergenic
1172180711 20:33001823-33001845 CACGCCCGGCTAATTTTTGTGGG + Intronic
1172373324 20:34414621-34414643 CACGCCCAGCTAATTTTGTGGGG + Intronic
1172609946 20:36243012-36243034 CACGCCCAGCTAATTATTTTTGG + Intronic
1172710793 20:36921678-36921700 CACACCCAGCTAATTTTTTGTGG + Intronic
1173203557 20:40972417-40972439 CATGCCCAGCTTATTTTTTAAGG + Intergenic
1173482983 20:43417502-43417524 CATGCCCAGCTAATTTTTGCTGG + Intergenic
1173516925 20:43671123-43671145 CATGCCCAGCTAATTTTTGTGGG + Intronic
1173635019 20:44547883-44547905 CATGCCCAGCCTATTTTTAATGG - Intronic
1173679778 20:44869861-44869883 AAGGCCCAGCTAATTTTTTGTGG - Intergenic
1173781183 20:45758733-45758755 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1174486981 20:50867501-50867523 CATGCCCAGCTAATTTTTTTGGG + Intronic
1174596162 20:51685403-51685425 CACGCCCAGCTAACTTTTTTTGG - Intronic
1174641365 20:52047282-52047304 CATGCCCAGCTAATTTTTGGTGG + Intergenic
1174841895 20:53908914-53908936 CATGCCCAGCATATTTTTTGTGG - Intergenic
1175058099 20:56216509-56216531 CATGCCCAGCTAATTGTTTGGGG - Intergenic
1176920716 21:14684363-14684385 CACTCCCACCTCATTTTTAATGG + Intergenic
1178362798 21:31963651-31963673 CATGCCCAGCTAATTTTTTTTGG + Intronic
1179788452 21:43742334-43742356 CATGCCCAGCTAACTTTTTGTGG + Intronic
1180628504 22:17210549-17210571 CACTGCAATCTGATTTTTAGTGG + Intronic
1180687116 22:17677887-17677909 CATGCCCAGCTAATTTTTGTGGG - Intronic
1180915908 22:19486965-19486987 CGTGCCCGGCTGCTTTTTAGAGG + Intronic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1181347750 22:22232444-22232466 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1181449672 22:23011203-23011225 CAGCCCAAGCTGATTTCTAGTGG - Intergenic
1181806428 22:25377214-25377236 TATGCCCAGCTAATTTTTGGTGG + Intronic
1182386974 22:29952043-29952065 CACGCCCAGCTAATTTTTGTGGG + Intronic
1182634891 22:31718226-31718248 CCCGCCCAGCTAATTTTTTGGGG + Intronic
1183042745 22:35194602-35194624 CACGCCCGGCTAATTCTTAATGG + Intergenic
1183813218 22:40275800-40275822 CACACCCAGCTAATTTTTGTAGG - Intronic
949695649 3:6691981-6692003 CACGCTCAGCTTATTTTATGAGG + Intergenic
950971890 3:17197531-17197553 CAAGCCCAGCTAATTTTTTTTGG + Intronic
951333618 3:21394804-21394826 CACACCGAGCTAATTTTTTGTGG + Intergenic
951667822 3:25146659-25146681 CGCGCCCGGCTAATTTTTTGTGG + Intergenic
952456726 3:33479496-33479518 CACACCCAGCTAATTTTTTGAGG + Intergenic
953775241 3:45811061-45811083 CATGCCCAGCTAATTTTTACAGG - Intergenic
953801457 3:46027035-46027057 CACACCTAGCTAATTTTTTGGGG + Intronic
953832096 3:46308075-46308097 CATGCCCGGCTGATTTTTGTGGG + Intergenic
954261163 3:49439911-49439933 CACGGCCAGCTAATTTTTGACGG + Intergenic
954737093 3:52715541-52715563 CAGGCCCAGCTAATTTTTTTTGG + Intronic
954883846 3:53854958-53854980 CACGCCCGGCTAATTTTTTGTGG - Intronic
955672038 3:61412171-61412193 CATGCCCAGCTAATTTTTTTTGG - Intergenic
956462847 3:69488734-69488756 CATGCCCAGCTAATTTTTAGTGG - Intronic
959538382 3:107512705-107512727 CACGCCCAGCCAATTTTTTTTGG - Intergenic
959748670 3:109807696-109807718 CACACCCAGCTAATTTTTTTTGG - Intergenic
960042332 3:113163248-113163270 CACGCTCATCAGATTATTAGAGG + Intergenic
960823217 3:121756495-121756517 CATGCCCAGCTAATTTTTGTGGG + Intergenic
960985168 3:123274378-123274400 CACGCCCAGCTTATTTTTTTTGG - Intergenic
961837752 3:129678082-129678104 CACACCTGGCTAATTTTTAGTGG + Intronic
961845881 3:129762623-129762645 CAAGCCCAGCTAATTTTTTTTGG - Intronic
962573596 3:136735767-136735789 CACGCCCAGCTAATTTTTTCTGG + Intronic
962578724 3:136778083-136778105 CATGCCCAGCTAATTTTTTGTGG - Intergenic
962607704 3:137046063-137046085 CATGCCCAGCTAATTTTTGCAGG - Intergenic
962771698 3:138616529-138616551 CACACCCAGCTAATTTTTTTTGG + Intronic
963302620 3:143616035-143616057 CACGCCCAGCTAATTTTTTTTGG + Intronic
963716097 3:148805538-148805560 CACGCCCGGCTAATTTTTTGTGG - Intronic
964148204 3:153491974-153491996 CACGCCCAGCCTAGTTTTTGAGG - Intronic
964341760 3:155715767-155715789 CATGCCCAGCTAATTTTTTGTGG + Intronic
965213472 3:165827788-165827810 AACGATCAGCTTATTTTTAGAGG - Intronic
966178484 3:177165931-177165953 CATGTCCAGCTAATTTTTTGTGG - Intronic
966547223 3:181163320-181163342 TACGCCCAGCTAATTTTTGGTGG - Intergenic
966716143 3:183014868-183014890 TACACCCAGCTTATTTTTTGTGG + Intergenic
967032885 3:185624709-185624731 CAGACCCAGTTAATTTTTAGTGG - Intronic
967148893 3:186630202-186630224 CACACCCAGCTAATTTTTGTGGG + Intergenic
967200893 3:187071602-187071624 CACGCCCGGCTAATTTTTTGGGG - Intronic
967960934 3:194923435-194923457 CATGACCAGCTAATTTTTTGTGG + Intergenic
968053146 3:195670008-195670030 CATGCCCAGCTAATTTTTGAGGG + Intergenic
968102667 3:195978353-195978375 CATGCCCAGCTAATTTTTGAGGG - Intergenic
968277230 3:197449634-197449656 CACGACCAGCTAATTTTTTATGG - Intergenic
968320934 3:197767619-197767641 TATGCCCAACTAATTTTTAGAGG + Intronic
968775996 4:2540488-2540510 CACGCCTGGCTAATTTTTTGGGG - Intronic
969071912 4:4546547-4546569 CATGCCCAGCTAATTTTTTGGGG + Intergenic
969226087 4:5799234-5799256 CAAGCTGAACTGATTTTTAGCGG - Intronic
970534214 4:17012560-17012582 CAGGCCATGCAGATTTTTAGAGG - Intergenic
970618483 4:17791585-17791607 CACACCCAGCTAATTTTTGTAGG - Intergenic
970885976 4:20987842-20987864 CACGCCCGGCTAATTTTTTTTGG - Intronic
971648379 4:29238133-29238155 CACGCCCAGCTAAGTTTTGTGGG - Intergenic
971668415 4:29523862-29523884 CTCTTCCAGCTGATTTTTAAAGG - Intergenic
972626419 4:40803903-40803925 CACACCTGGCTGATTTTTTGTGG - Intronic
972847799 4:43010537-43010559 TATGCCCAGATGAATTTTAGAGG + Intronic
974715813 4:65668800-65668822 CATGCCCAGGTGGGTTTTAGCGG + Intronic
975473692 4:74797637-74797659 CACACCCAGCTAATTTTTTGTGG + Intergenic
975540052 4:75499982-75500004 CATGCCCAGCTAATTTTTTGTGG - Intronic
976630736 4:87233415-87233437 AACGCCCAGCTAATTTTTGTTGG - Intronic
976779973 4:88748044-88748066 CACGCCCGGCTAATTTTTTTTGG + Intronic
977196447 4:94067065-94067087 CATGCCCAGCTAATTTTTGTGGG + Intergenic
980516515 4:133869157-133869179 CACGTCCAGCTAATGTTTTGGGG - Intergenic
981094586 4:140765081-140765103 CACCCCCAGGTGCTCTTTAGAGG - Intergenic
981294883 4:143120351-143120373 CATGCCTGGCTAATTTTTAGTGG - Intergenic
981601334 4:146492061-146492083 CACGCCCAGCTAATTTTTTTTGG - Intronic
981998756 4:151002855-151002877 TACACCCAGCTAATTTTTTGGGG - Intronic
982716619 4:158815537-158815559 CACGCCCAGCTAATTTGACGGGG + Intronic
983474543 4:168197616-168197638 CATGCCCAGCTAATTTTTTTTGG - Intergenic
984329734 4:178299020-178299042 CATGCCCAGCTAATTTTTGTGGG - Intergenic
984769926 4:183428441-183428463 CATGCCCAGCTAATTTTTCTGGG - Intergenic
987985667 5:25142285-25142307 CACGCCCAGCTAATTTTTAGTGG + Intergenic
988046814 5:25967005-25967027 CTCGCCCAGCTCATTTTTGAGGG - Intergenic
988654781 5:33197884-33197906 CATGCCCAGCTGATTTTGTGAGG - Intergenic
990169586 5:53033110-53033132 CACGCCCTGCTAATTTTTTATGG - Intronic
991481221 5:67082303-67082325 CACGCCCAGCTAATTTTTGTTGG + Intronic
992666786 5:79018202-79018224 CATGCCCGGCTAATTTTTTGTGG + Intronic
992693379 5:79260535-79260557 CATACCCAGCTGATTTTTGTGGG + Intronic
995442568 5:112208087-112208109 CACTCCCAGCTAATTTTTGTAGG - Intronic
995979346 5:118082381-118082403 CATGCCCAGCCGATTCTTAAAGG + Intergenic
996638697 5:125727742-125727764 CATGCCCAGCAAATTTTTTGTGG + Intergenic
997329015 5:133045655-133045677 CATGCCCAGCTAATTTTTTTGGG - Intergenic
997673917 5:135698129-135698151 GAAGCCCAGCTGGTTGTTAGAGG - Intergenic
997948823 5:138225545-138225567 CAAGCCCAGATAATTTTTTGAGG + Intergenic
998087174 5:139336041-139336063 CATGCCCAGCTAATTTTTGTAGG + Intergenic
998508570 5:142692178-142692200 CACACCCAGCTAATTTTTGTGGG - Intronic
999061329 5:148638888-148638910 CACGCCCATCTAATTTTTTGTGG - Intronic
999754883 5:154656940-154656962 CACACCCAGCTAATTTTTTTTGG - Intergenic
999831100 5:155320998-155321020 CATGCCCAGCTAATTTTTTGTGG + Intergenic
1000092426 5:157941244-157941266 CACGCCCAGCTAATTTTTGTGGG + Intergenic
1000170101 5:158693987-158694009 CACGCCCAGCTAATTTTTTTTGG + Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1001978201 5:176018177-176018199 CACATCCAGCTAATTTTTAGGGG + Intronic
1002015531 5:176318950-176318972 TAAGCCCAGCTAATTTTTTGTGG - Intronic
1002162737 5:177325630-177325652 CATGCCCAGCTAGTTTTTGGCGG - Intergenic
1002220717 5:177678533-177678555 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1002239218 5:177825585-177825607 CACATCCAGCTAATTTTTAGGGG - Intergenic
1002290382 5:178196403-178196425 CACGCCCTGCTGAGTCTCAGAGG - Intergenic
1002392240 5:178924214-178924236 CATGCCCGGCTAATTTTTTGTGG - Intronic
1002511068 5:179718155-179718177 CACGCCTGGCTAATTTTTATGGG + Intronic
1002678631 5:180940934-180940956 CAAGCCCAGCTAATTTTTATGGG - Intronic
1003836588 6:10077875-10077897 CACACCTGGCTAATTTTTAGTGG - Intronic
1004082937 6:12413512-12413534 CCCACCCAGCCTATTTTTAGAGG - Intergenic
1004313663 6:14567513-14567535 CACGCCCAGCTAATTTTTTTCGG - Intergenic
1004420759 6:15467677-15467699 CACACCCAGCTAATTTTTTGTGG - Intronic
1004447927 6:15718291-15718313 CACACCCAGCTAATTTATAAGGG - Intergenic
1004896243 6:20150718-20150740 TACGCCCAGCTAATTTTTTTTGG + Intronic
1005544469 6:26850506-26850528 TACGCTCAGCTAATTTTTTGTGG - Intergenic
1006477523 6:34267019-34267041 CACACCCAGCTGAATTTTGTTGG - Intergenic
1006611193 6:35295501-35295523 GGCGCCCAGCTGATTTTGAGAGG - Exonic
1007040404 6:38716113-38716135 CACGCCCGGCTAATTTTTTTTGG + Intronic
1007153950 6:39724294-39724316 CACGCCCGGTTAATTTTTTGTGG - Intronic
1007760482 6:44130594-44130616 CATGCCCAGCTAAATTTTGGTGG + Intronic
1007883390 6:45193557-45193579 CATGCCCAGCTAATTTTTTGAGG - Intronic
1011605077 6:89095367-89095389 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1011741164 6:90362103-90362125 CACACCCAGCTAATTTTTTGGGG - Intergenic
1014189965 6:118484157-118484179 CACGCCCAGCTAATTTTTTTGGG - Intronic
1015596008 6:134867755-134867777 CATGCCCGGCTAATTTTTGGAGG + Intergenic
1016318665 6:142818510-142818532 CACGCCTGGCTAATTTTTTGTGG - Intronic
1016917027 6:149253472-149253494 CACGCCCGGCTAATTTTTGATGG - Intronic
1016961993 6:149682566-149682588 CATGCCCAGCTAATTTTTTTTGG + Intronic
1017546085 6:155451779-155451801 CACGCCCAGCTAATATTTTTTGG + Intronic
1017804897 6:157936350-157936372 TACACCCAGCTAATTTTTGGGGG - Intronic
1017934445 6:158992434-158992456 CATGCCCAGCTAATTTTTGTGGG + Intronic
1018206278 6:161440105-161440127 CACGCCCGGCTAATTTTTTTTGG + Intronic
1019584492 7:1790483-1790505 CACGCCCAGCTCATTTTTTGGGG - Intergenic
1019646788 7:2134795-2134817 CATGCCCACCTGATTTCTGGTGG - Intronic
1019668729 7:2266634-2266656 CACGCCCGGCCGGTTTTTTGGGG + Intronic
1019794794 7:3041726-3041748 CACGCCGGGCTAATTTTTTGTGG + Intronic
1019923797 7:4179509-4179531 CAAGCCCAGCGGATTTTTTCCGG + Intronic
1019991645 7:4695957-4695979 CACACCCAGCTAATTTTTGTGGG - Intronic
1021034566 7:15782203-15782225 CAGGCCAAGCTGACTTTGAGAGG - Intergenic
1021684492 7:23170055-23170077 CACGCCCGGCTAATTTTTTTTGG - Intronic
1021729715 7:23584690-23584712 TACGCCCAACTAATTTTTTGGGG + Intergenic
1022682847 7:32566331-32566353 CACGCCCAGCTAATTTTTTGTGG + Intronic
1023500081 7:40839397-40839419 CCTGCCCAGCTAATTTTTATTGG + Intronic
1023906235 7:44523572-44523594 CATGCCCAGCTGATATTTGGTGG - Intronic
1024157819 7:46643333-46643355 CACACCCAGCTAATTTTTTGTGG + Intergenic
1024442286 7:49434484-49434506 CAAGCCCAGCTGATGTTGATGGG + Intergenic
1024568054 7:50699980-50700002 CACGCCCGGCTAATTTTTTTTGG - Intronic
1024606143 7:51024150-51024172 CACGCCCGGCTAATTTTTTGTGG - Intronic
1024747701 7:52427395-52427417 CACGCCCAGCTAATTTTTGTTGG + Intergenic
1025922788 7:65929254-65929276 CACACCCAGCTAATTTTTTTTGG - Intronic
1025974070 7:66355746-66355768 CACACCCAGCTAATTTTTTTTGG - Intronic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1026724253 7:72858307-72858329 CACGCCCAGCTAACTTTTGTAGG - Intergenic
1026760723 7:73123912-73123934 CACGTCCAGCTAATTTTTGTGGG + Intergenic
1026814233 7:73497084-73497106 CACACCCAGCTAATTTTTGTAGG - Intronic
1026840210 7:73666583-73666605 CACGCCCGGCTAATTTTTGTTGG + Intergenic
1027037067 7:74932707-74932729 CACGTCCAGCTAATTTTTGTGGG + Intergenic
1027086497 7:75268740-75268762 CACGTCCAGCTAATTTTTGTGGG - Intergenic
1027148684 7:75716808-75716830 CACGCCCAGCTTTTTTTTAGGGG + Intronic
1027527556 7:79289303-79289325 CCCTCCCAGTTAATTTTTAGTGG - Intronic
1027787586 7:82599500-82599522 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1028548908 7:92034655-92034677 CACACCCAGCTAATTTTTGTGGG + Intronic
1029030154 7:97458622-97458644 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1029392798 7:100286755-100286777 CACGTCCAGCTAATTTTTGTGGG - Intergenic
1029481361 7:100815164-100815186 CATGCCCAGCTAATTTTTTTTGG - Intronic
1029589941 7:101500662-101500684 CACGCCCAGCTAATTTTTGTGGG - Intronic
1029591792 7:101511834-101511856 CATGCCCAGCTAATTTTGGGGGG - Intronic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1029715435 7:102322898-102322920 CACGCCTAGCTAATTTTTTTTGG + Intergenic
1030071654 7:105703145-105703167 CACGCCCAGCTAATTTTTTGGGG - Intronic
1030090467 7:105853605-105853627 CACGCCCAGCTCATTTTTGTGGG - Intronic
1030224845 7:107138838-107138860 CATGCCCAGCTTATTTTTTTTGG + Intronic
1030564618 7:111137979-111138001 CACACCCAGCTAATTTTTGTGGG + Intronic
1033373767 7:140736891-140736913 CACACCCAGCTAATTTCTTGTGG - Intronic
1033714380 7:143984646-143984668 CGCGCCCAGCTAATTTTTAGTGG - Intergenic
1034458206 7:151183243-151183265 CATTCCCAGCTAATTTTTTGTGG - Intronic
1034614014 7:152398981-152399003 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1035160859 7:156949349-156949371 CACGCTCAGCTAATTTTTGTAGG + Intergenic
1035450138 7:158972682-158972704 CACGCCCAGCTAATTTTTTGTGG + Intergenic
1035848639 8:2891777-2891799 CACGCCCAGCTAATTTTTGTAGG + Intergenic
1036164830 8:6422843-6422865 CACGCCCGGCTAATTTTTTGTGG + Intronic
1037894872 8:22645323-22645345 CACGCCCGGCTAATTTTTGGTGG - Intronic
1037959758 8:23087608-23087630 CACGCCTAGCTAATTTTTGTAGG - Intronic
1037971117 8:23172647-23172669 CACGCCCGGCTAATTTTTTATGG - Intergenic
1038272376 8:26085804-26085826 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1038563975 8:28604333-28604355 CACGCCAAGCTAATTTTTATGGG + Intronic
1039853400 8:41391780-41391802 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1040466228 8:47697759-47697781 CAAATACAGCTGATTTTTAGAGG + Intronic
1040917734 8:52580701-52580723 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1041061519 8:54039401-54039423 CACGCCCGGCTAATATTTTGTGG + Intergenic
1041492250 8:58446951-58446973 CATGCCCAGCTAATTTTTTCTGG + Intronic
1042532384 8:69829519-69829541 CGTGCCCAGCTAATTTTTTGTGG - Intronic
1042717506 8:71790546-71790568 CACACCCCGCTAATTTTTTGTGG - Intergenic
1042905194 8:73765501-73765523 CATGCCCAGCTAATTTTTGTGGG + Intronic
1043503507 8:80879391-80879413 CACGCTCAGCTAGTTTTTGGGGG + Intergenic
1043525073 8:81087705-81087727 CAAGCCCAGCTAATGTTTCGGGG + Intronic
1044212900 8:89571545-89571567 CACGCCCGGCTAATTTTTGGTGG + Intergenic
1044321858 8:90811102-90811124 CATGCCCGGCTAATTTTTTGGGG + Intronic
1045226400 8:100250249-100250271 CACACCTAGCTGATTTTTGTGGG - Intronic
1046534285 8:115488516-115488538 CACGCCCAGCTAATTTTTTGGGG - Intronic
1047395316 8:124492478-124492500 CACACCCAGCCAATTTTTTGGGG - Intronic
1047702941 8:127468492-127468514 CACTCCCAGCTAATTTTTGTTGG - Intergenic
1047791622 8:128209519-128209541 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1048338547 8:133521288-133521310 CACACCCAGCTAATTTTTGGGGG + Intronic
1048777540 8:137963965-137963987 CACGCCCAGCTAATTTTTTGTGG - Intergenic
1049108829 8:140630110-140630132 CACGCCCATCAGATTTTCTGAGG + Intronic
1051495526 9:17718569-17718591 CATGCCCAGCTAATTTTTGTGGG - Intronic
1051627661 9:19113728-19113750 CATGCCCAGCTAATTTTTGTGGG + Intronic
1051887355 9:21907399-21907421 CATGCCCAGCTAATTTTTGTAGG - Intronic
1052531438 9:29689503-29689525 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1052782389 9:32794825-32794847 CATGACCAGCTGCTTTTAAGTGG + Intergenic
1052936794 9:34099938-34099960 CATCCACAGCTGACTTTTAGTGG + Intronic
1053194361 9:36104491-36104513 CACGCCCAGCTAAATTTGAGGGG + Intronic
1054556308 9:66660773-66660795 CACACCCAGCTAATTTTTTTAGG - Intergenic
1054781163 9:69167082-69167104 CACGCCCAGCTAATTTTTCTGGG - Intronic
1054849146 9:69828524-69828546 CACACCCGGCTAATTTTTGGTGG - Intronic
1055018127 9:71641175-71641197 CACACCCAGCTAATTTTTGTAGG - Intergenic
1055219499 9:73911196-73911218 CATGCCAAGCTAATTTTTTGGGG - Intergenic
1058138434 9:101333621-101333643 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1058454076 9:105123159-105123181 CACACCCAGCTAATTTTTGGTGG - Intergenic
1058987300 9:110220203-110220225 CACACCCAGCTAATTTTTTGTGG - Intergenic
1059298771 9:113296436-113296458 CACGCCCAGCTAATCTTTGCTGG + Intergenic
1059914700 9:119085971-119085993 CACACCCAGCTAATTTTTGTGGG - Intergenic
1061562312 9:131413530-131413552 CACACCCAGCTAATTTTTAGTGG + Intronic
1061616942 9:131786620-131786642 CATGCCTAGCTAATTTTTTGTGG + Intergenic
1061827033 9:133264909-133264931 CACATCTAGCTGATTTTTTGTGG + Intronic
1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG + Intergenic
1187009749 X:15267255-15267277 CACGCCTGGCTAATTTTTTGGGG - Intronic
1187153522 X:16703179-16703201 CACGCCCTGCTAATTTTTGTGGG + Intronic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1189349429 X:40265888-40265910 CACGCCCAGCTAAATTTTTTTGG - Intergenic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1189943155 X:46148659-46148681 CAGGTCCAGATGATTTTTAGTGG - Intergenic
1190170632 X:48109184-48109206 CACCCCCAGCTAATTTTTTTTGG + Intergenic
1190196991 X:48328405-48328427 CACGCCCCGCTGATTTTTTTAGG + Intergenic
1190663724 X:52678784-52678806 CACGCCCCACTGATTTTTTTAGG + Intronic
1190675699 X:52779638-52779660 CACGCCCCACTGATTTTTTTAGG - Intronic
1191177309 X:57517557-57517579 CACTCCCAGCAGATCTTTGGAGG - Intergenic
1193730563 X:85097492-85097514 CATGCCCAGCTAATTTTTTAAGG + Intronic
1195132585 X:101868455-101868477 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1195196401 X:102501535-102501557 CATACCCAGCTAATTTTTTGTGG + Intergenic
1196554299 X:117069653-117069675 CACTCCTAGCAGATCTTTAGAGG + Intergenic
1196767451 X:119260494-119260516 CATCCCCAGCAGATTTTTAATGG - Intergenic
1196789793 X:119453688-119453710 CACACCTAGCTAATTTTTTGGGG + Exonic
1196908263 X:120460114-120460136 CAAGCCCAGCAAATTTTTAGTGG - Intronic
1197305308 X:124834326-124834348 CACGCCCGGCTAATTTTTGTAGG + Intronic
1197780747 X:130157792-130157814 CCTGCCCAGCTAATTTTTAACGG - Intronic
1197859579 X:130956238-130956260 CACGCCCGGCTAATTTTTTGTGG - Intergenic
1198261772 X:134971131-134971153 CACACCCAGCTTTTTTTTGGGGG - Intergenic
1198462457 X:136876862-136876884 CACACCCAGCTAATTTTTGGTGG + Intronic
1199005440 X:142691302-142691324 CCCGCCCTGCTCATTTTTAATGG - Intergenic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1199255126 X:145710708-145710730 CACACCCAGCTGAATTTTTTTGG - Intergenic
1199756278 X:150867923-150867945 CACGCCCAGCTAATTTTTGTAGG - Intronic
1200902182 Y:8443936-8443958 CACACCCAGCTTATATTTAATGG - Intergenic
1201055488 Y:9985979-9986001 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1201497194 Y:14601256-14601278 CTCGCCCACCTAATTTTTGGTGG + Intronic
1201587924 Y:15581786-15581808 CATGCCCAGCTAATTTTTTTAGG + Intergenic