ID: 1140881315

View in Genome Browser
Species Human (GRCh38)
Location 16:79200355-79200377
Sequence TGATTCTGGGGTGCTACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140881310_1140881315 -2 Left 1140881310 16:79200334-79200356 CCAGATTTTCAAGTGTATGCATG 0: 1
1: 0
2: 1
3: 22
4: 180
Right 1140881315 16:79200355-79200377 TGATTCTGGGGTGCTACAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 111
1140881308_1140881315 17 Left 1140881308 16:79200315-79200337 CCCGCTCTCAGATCTGAGGCCAG 0: 1
1: 0
2: 2
3: 24
4: 257
Right 1140881315 16:79200355-79200377 TGATTCTGGGGTGCTACAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 111
1140881309_1140881315 16 Left 1140881309 16:79200316-79200338 CCGCTCTCAGATCTGAGGCCAGA 0: 1
1: 0
2: 2
3: 34
4: 225
Right 1140881315 16:79200355-79200377 TGATTCTGGGGTGCTACAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140881315 Original CRISPR TGATTCTGGGGTGCTACAAA GGG Intronic
900768971 1:4525616-4525638 TGATTGTTGGATGCTACACAAGG + Intergenic
902251417 1:15156093-15156115 AGATTCTGGGGTTCTACATGAGG + Intronic
903704867 1:25278447-25278469 TGATTCTGTGGTGCAACAACTGG + Intronic
903722364 1:25414874-25414896 TGATTCTGTGGTGCAACAACTGG - Intronic
905731442 1:40301659-40301681 AGACTCCGGGGTGCTCCAAAGGG + Intronic
907890456 1:58631735-58631757 TCATTGTGTGTTGCTACAAAAGG - Intergenic
913349320 1:117840838-117840860 TGATTGAGGGGTACTACCAAGGG + Intergenic
914346171 1:146800079-146800101 TGATTTTGGGGGGCTACTAAAGG - Intergenic
916968013 1:169973963-169973985 TAATTCTGAGATGTTACAAAAGG + Intronic
919964978 1:202513784-202513806 TGATTGTGGGGTGCTAAGGAGGG + Intronic
920120470 1:203652735-203652757 TTGTTTTGGGGTGCTACAAATGG + Intronic
921319267 1:213922402-213922424 TATTTCTGGGGTGATAAAAATGG - Intergenic
924207015 1:241723313-241723335 TGATATTGGGGTGCCACAACCGG - Exonic
1064769895 10:18712329-18712351 TGCTTCAGAGGTGCTGCAAAGGG + Intergenic
1065564442 10:26994794-26994816 TGACTTTGGGATGCTACAGAAGG - Intronic
1065802196 10:29362730-29362752 TGATTATGGGATGCTTAAAATGG + Intergenic
1072194934 10:93109431-93109453 TCCTTCTGGGGTGATAAAAATGG - Intergenic
1076160350 10:128239014-128239036 AGATTCTGGGGAGATGCAAAGGG + Intergenic
1076619761 10:131779685-131779707 TTATTCTGGGGGGTTATAAATGG + Intergenic
1080012918 11:27476071-27476093 TGATTGGGGAGTGGTACAAAGGG - Intergenic
1080189158 11:29524452-29524474 TGATTCTGGGGTCAGACAATGGG + Intergenic
1080223390 11:29933411-29933433 GGATTCTGGGATTCTACAACAGG - Intergenic
1086298309 11:85396262-85396284 TGATTCTGGTGTCCTAAAGATGG - Intronic
1088201900 11:107346095-107346117 TCATACTGTGGTGATACAAAAGG - Intronic
1090292558 11:125558393-125558415 TAATTCTGGGATACTACAGAGGG + Intergenic
1090936973 11:131351877-131351899 TGATTCTGGGCTGCTATACCAGG + Intergenic
1094586469 12:31781961-31781983 TGATACTGGAGTGCTGGAAAGGG + Intergenic
1095306735 12:40647305-40647327 TAATTGTGGGGTTTTACAAAAGG - Intergenic
1096002952 12:48144620-48144642 TAATTCTGAGGTGCTACCAAGGG + Intronic
1096923975 12:55121483-55121505 TAATTCTGGGGAGATACGAATGG + Intergenic
1098293867 12:68984499-68984521 TGATTCAGCGTTGCTACAATGGG + Intergenic
1101378321 12:104190232-104190254 TCATTCTGTTGTGCCACAAAGGG + Intergenic
1101712028 12:107276449-107276471 ACATTCTAGGGTTCTACAAAAGG - Intergenic
1105891740 13:24687033-24687055 TGAGTCTGGGGTTCTGGAAAAGG + Intronic
1107721519 13:43253439-43253461 TGGTTCTGCAGTGCTGCAAAGGG - Intronic
1116091940 14:40319958-40319980 TAATGCAGGGTTGCTACAAAAGG + Intergenic
1118933243 14:70262699-70262721 TGATTCTGAGGTGGAACACATGG - Intergenic
1124793045 15:32748234-32748256 GGCTTCTGGCTTGCTACAAAAGG - Intergenic
1125248718 15:37674572-37674594 TGATTCTGGGGTGGTCGTAAGGG + Intergenic
1132769668 16:1554379-1554401 TGAGTCTGGGGGGCTAGGAAAGG + Intronic
1133789254 16:8996605-8996627 TGATTCTGGGGTGCAAACAGAGG - Intergenic
1137917063 16:52443381-52443403 TGATTCTGAGCAGCTGCAAATGG + Intronic
1139987808 16:70915188-70915210 TGATTTTGGGGGGCTACTAAAGG + Intronic
1140881315 16:79200355-79200377 TGATTCTGGGGTGCTACAAAGGG + Intronic
1142604562 17:1074332-1074354 TGATTCTGGGGTCCTGCATGTGG - Intronic
1144802900 17:17943391-17943413 TGCTGCTGGGGTGCGACAGAGGG + Intronic
1145100656 17:20073880-20073902 TGATTTTGGGGGGCTGAAAAAGG + Intronic
1147045621 17:37749775-37749797 GGTTTCTGGGGTGCTAGAAATGG + Intergenic
1147896961 17:43757422-43757444 GGACTATGGGGTGCTAAAAAGGG - Intronic
1151059545 17:71075853-71075875 TCATTCTGGAGAGTTACAAATGG - Intergenic
1151513212 17:74575008-74575030 TGCTTCAGGGGTGTTGCAAAGGG + Intergenic
1161433828 19:4250116-4250138 TAATTCTGAAGTGCTACAAAAGG - Intronic
928947156 2:36781904-36781926 TGATTTAAGGGTCCTACAAAGGG + Intronic
936283369 2:111161817-111161839 TGGTTTTGGGGTGGTATAAAGGG - Intronic
941921068 2:170851209-170851231 TGATTCTTTGCTGCTACAAAAGG - Intronic
942807475 2:179949184-179949206 TGATTCAGGGATGCTACTGAGGG + Intronic
942952131 2:181732650-181732672 TGATTATGGTGAGCTACAGATGG - Intergenic
946202898 2:218081250-218081272 TGAATCTGGGCTGCCACAAAGGG - Intronic
947793031 2:232878489-232878511 TGTTTCTGGAGTCCTACAAGTGG + Intronic
1173330074 20:42068425-42068447 TCTCTCTGGGGTGCTTCAAATGG + Intergenic
1173930078 20:46811153-46811175 AGACCCTGGGGTGCGACAAAGGG + Intergenic
1174418329 20:50382679-50382701 TGACTCAGGGGTGCTACCAGGGG + Intergenic
1174461835 20:50688850-50688872 TCATCCTGGGGAGCTCCAAAGGG - Intronic
1180353123 22:11819972-11819994 TGATTCCGGGGTGCTTGGAACGG - Intergenic
1180385120 22:12172385-12172407 TGATTCCGGGGTGCTTGGAACGG + Intergenic
950600627 3:14032186-14032208 AGATTTTGGGGTACTACAGATGG + Intronic
953339763 3:42123484-42123506 AGATCCTGGGGTGCTCCACACGG - Intronic
953496696 3:43393726-43393748 TAACTCTGGGATGTTACAAAAGG + Intronic
955590180 3:60526494-60526516 TGCTTCTGGGCTTCTTCAAAGGG + Intronic
956489811 3:69758735-69758757 TGTTTCTGGTGTGCTAGAAGGGG + Intronic
957263889 3:77935619-77935641 TGATACTAGGGTGCTTTAAAGGG + Intergenic
963099448 3:141585243-141585265 TGATTGTGGGGTGCTACCCTAGG - Intronic
965205433 3:165714825-165714847 TAATTTTGGGATGCTACAGAGGG - Intergenic
966705809 3:182912105-182912127 GGAGTCTGGGTTGCTACAAGGGG + Intronic
971253635 4:24994028-24994050 TCATTCTGGGGTCCTGAAAAAGG - Intergenic
972028707 4:34423253-34423275 TGAGTTGGGGCTGCTACAAAAGG + Intergenic
973127355 4:46604170-46604192 TGATTCTGTCATGCTACAGATGG - Intergenic
978200181 4:106016654-106016676 TGATTCTGAGGTACTGCAATAGG - Intergenic
981259577 4:142703881-142703903 TCATACTGGGGTGCACCAAATGG - Intronic
982530020 4:156528774-156528796 TGCTTCTCTGGTGCTACAGATGG - Intergenic
982978308 4:162095986-162096008 TGTGTCTGGGTTGCTACAATCGG - Intronic
984748374 4:183245997-183246019 TGATTCTGGGGTGCCAGCTAAGG + Intronic
987040968 5:14061732-14061754 AGATTCTGGGCTGCTTCAAAGGG + Intergenic
991260923 5:64666875-64666897 TGATTCAGGGGTCCCTCAAAAGG - Intergenic
999868138 5:155724041-155724063 AGATTCTGGGATGCCATAAAGGG - Intergenic
1000231285 5:159317586-159317608 GGAGTCTGGGGCGGTACAAAAGG + Intronic
1001002258 5:168018734-168018756 TGATTCTGGGGTGCCTCCTAAGG + Intronic
1001160393 5:169307483-169307505 TCCTTCTGGGGTGCTAAAACTGG + Intergenic
1004063361 6:12219615-12219637 GGTTTCTGGGGTGCTAGAAGTGG - Intergenic
1006792056 6:36708725-36708747 TGATTCTGGGGAGATAGATAGGG + Intronic
1008822702 6:55652573-55652595 TGATTCTGTGGTTCTGCAAGTGG + Intergenic
1009829420 6:68911621-68911643 TGATTCAGCAGTGTTACAAAAGG + Intronic
1011577284 6:88816717-88816739 TGATTCTAGGGTGCTCGCAAAGG - Intronic
1011742883 6:90380828-90380850 TGACTGTGGGATGCTAGAAAGGG + Intergenic
1013823949 6:114188547-114188569 TGCTTCTGGGGAGCTGAAAATGG - Intronic
1014102522 6:117527549-117527571 TTATTCTGTGTTGCTCCAAAAGG + Intronic
1016581610 6:145634434-145634456 ACATTCTGGGGAGCGACAAAGGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024447586 7:49499522-49499544 TTATTATGGGGTGTTATAAATGG - Intergenic
1028490715 7:91408484-91408506 TGATTCAGTGGTCATACAAATGG + Intergenic
1028675894 7:93460138-93460160 TGATTCTAGTGTGCCACAAATGG - Intronic
1029540626 7:101180137-101180159 TGACTCTTGGGGGCTCCAAAGGG - Exonic
1029956755 7:104648455-104648477 TGATTCTGTGATGCCACCAATGG - Intronic
1032258434 7:130315270-130315292 TGACTCTGAGGTGGAACAAAAGG + Intronic
1034804712 7:154079541-154079563 TGATTCTGGGGACCTAGAGATGG + Intronic
1034849857 7:154483459-154483481 TGGTTCTGGGGTTCTACCAAGGG + Intronic
1034852476 7:154507877-154507899 TGATTCTGAGTTGCTCCAAAAGG - Intronic
1040643940 8:49376770-49376792 TGATTCTGGGGTGCAGGCAAAGG + Intergenic
1043107195 8:76129128-76129150 TGACTCTGGGGTGCTAGCCATGG + Intergenic
1043983148 8:86663637-86663659 TGATTCAGTGGTGTTACCAATGG + Intronic
1044810808 8:96059313-96059335 TGCTTCTGGGATACAACAAAGGG + Intergenic
1045910745 8:107406518-107406540 TGATTCTGGGATCCTCAAAAGGG - Intronic
1051225813 9:14898030-14898052 TGATTCAGTAGTGCTAAAAAAGG + Intronic
1055150051 9:72986183-72986205 TGATTGTAGGATCCTACAAATGG - Intronic
1055164652 9:73176357-73176379 TGATTCAGTGTTGCTACAATGGG + Intergenic
1055342539 9:75299938-75299960 TGCATCTGTGTTGCTACAAAGGG + Intergenic
1190914863 X:54803846-54803868 TGATTTATGGGTGCTAGAAATGG + Intergenic
1194828166 X:98589057-98589079 TGACTTTGGGATGCTACAGAAGG - Intergenic
1197464642 X:126788013-126788035 TGCTTCTGAAGTGCTATAAAAGG - Intergenic
1198064063 X:133078306-133078328 CTATTTTGGGTTGCTACAAAGGG - Intronic
1198762821 X:140051368-140051390 TGATTGTGTGGAGCCACAAAAGG + Intergenic
1199616608 X:149660763-149660785 TGATCCTCGGGTGCTCCAGAGGG + Intergenic
1199626033 X:149742485-149742507 TGATCCTCGGGTGCTCCAGAGGG - Intergenic
1200534297 Y:4375619-4375641 TGATTCAGGTTTGCTACAATGGG + Intergenic
1202300607 Y:23409611-23409633 TGATTGTGGGGTGCTAAGGAGGG + Intergenic
1202570204 Y:26260987-26261009 TGATTGTGGGGTGCTAAGGAGGG - Intergenic