ID: 1140893656

View in Genome Browser
Species Human (GRCh38)
Location 16:79306453-79306475
Sequence AAGCAATGCTCCGTGGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140893656_1140893667 10 Left 1140893656 16:79306453-79306475 CCCTGACCCACGGAGCATTGCTT No data
Right 1140893667 16:79306486-79306508 TAGAGAGGAAGAGAGGTTGGTGG No data
1140893656_1140893662 -5 Left 1140893656 16:79306453-79306475 CCCTGACCCACGGAGCATTGCTT No data
Right 1140893662 16:79306471-79306493 TGCTTGGCCTCCTGGTAGAGAGG No data
1140893656_1140893668 19 Left 1140893656 16:79306453-79306475 CCCTGACCCACGGAGCATTGCTT No data
Right 1140893668 16:79306495-79306517 AGAGAGGTTGGTGGCTTACAAGG No data
1140893656_1140893666 7 Left 1140893656 16:79306453-79306475 CCCTGACCCACGGAGCATTGCTT No data
Right 1140893666 16:79306483-79306505 TGGTAGAGAGGAAGAGAGGTTGG No data
1140893656_1140893664 3 Left 1140893656 16:79306453-79306475 CCCTGACCCACGGAGCATTGCTT No data
Right 1140893664 16:79306479-79306501 CTCCTGGTAGAGAGGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140893656 Original CRISPR AAGCAATGCTCCGTGGGTCA GGG (reversed) Intergenic
No off target data available for this crispr