ID: 1140894251

View in Genome Browser
Species Human (GRCh38)
Location 16:79311142-79311164
Sequence GCTGCGGGAGGGAGAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140894251_1140894261 19 Left 1140894251 16:79311142-79311164 CCAGGCTCTCTCCCTCCCGCAGC No data
Right 1140894261 16:79311184-79311206 CTGCTTTAAGCGCAGGAGAAAGG No data
1140894251_1140894260 12 Left 1140894251 16:79311142-79311164 CCAGGCTCTCTCCCTCCCGCAGC No data
Right 1140894260 16:79311177-79311199 CTCTAAGCTGCTTTAAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140894251 Original CRISPR GCTGCGGGAGGGAGAGAGCC TGG (reversed) Intergenic
No off target data available for this crispr