ID: 1140894693

View in Genome Browser
Species Human (GRCh38)
Location 16:79314617-79314639
Sequence TAAGATTCCTGAATTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140894693_1140894696 -6 Left 1140894693 16:79314617-79314639 CCAGAGCCAATTCAGGAATCTTA No data
Right 1140894696 16:79314634-79314656 ATCTTAGCTGGAGCAAATGCCGG No data
1140894693_1140894705 26 Left 1140894693 16:79314617-79314639 CCAGAGCCAATTCAGGAATCTTA No data
Right 1140894705 16:79314666-79314688 CTGGAGGGTCATCAAAGCAATGG No data
1140894693_1140894698 7 Left 1140894693 16:79314617-79314639 CCAGAGCCAATTCAGGAATCTTA No data
Right 1140894698 16:79314647-79314669 CAAATGCCGGCTGGTTCCCCTGG No data
1140894693_1140894697 -2 Left 1140894693 16:79314617-79314639 CCAGAGCCAATTCAGGAATCTTA No data
Right 1140894697 16:79314638-79314660 TAGCTGGAGCAAATGCCGGCTGG No data
1140894693_1140894700 11 Left 1140894693 16:79314617-79314639 CCAGAGCCAATTCAGGAATCTTA No data
Right 1140894700 16:79314651-79314673 TGCCGGCTGGTTCCCCTGGAGGG No data
1140894693_1140894699 10 Left 1140894693 16:79314617-79314639 CCAGAGCCAATTCAGGAATCTTA No data
Right 1140894699 16:79314650-79314672 ATGCCGGCTGGTTCCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140894693 Original CRISPR TAAGATTCCTGAATTGGCTC TGG (reversed) Intergenic