ID: 1140894695

View in Genome Browser
Species Human (GRCh38)
Location 16:79314623-79314645
Sequence TCCAGCTAAGATTCCTGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140894695_1140894700 5 Left 1140894695 16:79314623-79314645 CCAATTCAGGAATCTTAGCTGGA No data
Right 1140894700 16:79314651-79314673 TGCCGGCTGGTTCCCCTGGAGGG No data
1140894695_1140894697 -8 Left 1140894695 16:79314623-79314645 CCAATTCAGGAATCTTAGCTGGA No data
Right 1140894697 16:79314638-79314660 TAGCTGGAGCAAATGCCGGCTGG No data
1140894695_1140894706 25 Left 1140894695 16:79314623-79314645 CCAATTCAGGAATCTTAGCTGGA No data
Right 1140894706 16:79314671-79314693 GGGTCATCAAAGCAATGGCTAGG No data
1140894695_1140894699 4 Left 1140894695 16:79314623-79314645 CCAATTCAGGAATCTTAGCTGGA No data
Right 1140894699 16:79314650-79314672 ATGCCGGCTGGTTCCCCTGGAGG No data
1140894695_1140894705 20 Left 1140894695 16:79314623-79314645 CCAATTCAGGAATCTTAGCTGGA No data
Right 1140894705 16:79314666-79314688 CTGGAGGGTCATCAAAGCAATGG No data
1140894695_1140894698 1 Left 1140894695 16:79314623-79314645 CCAATTCAGGAATCTTAGCTGGA No data
Right 1140894698 16:79314647-79314669 CAAATGCCGGCTGGTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140894695 Original CRISPR TCCAGCTAAGATTCCTGAAT TGG (reversed) Intergenic