ID: 1140894699

View in Genome Browser
Species Human (GRCh38)
Location 16:79314650-79314672
Sequence ATGCCGGCTGGTTCCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140894691_1140894699 28 Left 1140894691 16:79314599-79314621 CCAGTTTGGCAAGGTAAGCCAGA No data
Right 1140894699 16:79314650-79314672 ATGCCGGCTGGTTCCCCTGGAGG No data
1140894693_1140894699 10 Left 1140894693 16:79314617-79314639 CCAGAGCCAATTCAGGAATCTTA No data
Right 1140894699 16:79314650-79314672 ATGCCGGCTGGTTCCCCTGGAGG No data
1140894695_1140894699 4 Left 1140894695 16:79314623-79314645 CCAATTCAGGAATCTTAGCTGGA No data
Right 1140894699 16:79314650-79314672 ATGCCGGCTGGTTCCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140894699 Original CRISPR ATGCCGGCTGGTTCCCCTGG AGG Intergenic