ID: 1140896085

View in Genome Browser
Species Human (GRCh38)
Location 16:79325483-79325505
Sequence ACAGCTAGTAAGTGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140896076_1140896085 28 Left 1140896076 16:79325432-79325454 CCCAGGAGGCTCATGAAGCTCAG No data
Right 1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG No data
1140896077_1140896085 27 Left 1140896077 16:79325433-79325455 CCAGGAGGCTCATGAAGCTCAGA No data
Right 1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140896085 Original CRISPR ACAGCTAGTAAGTGGAAAGC AGG Intergenic
No off target data available for this crispr