ID: 1140897370

View in Genome Browser
Species Human (GRCh38)
Location 16:79336452-79336474
Sequence GCTTCTTCAGGGATGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140897365_1140897370 -7 Left 1140897365 16:79336436-79336458 CCTAATTATTCTATTAGCTTCTT No data
Right 1140897370 16:79336452-79336474 GCTTCTTCAGGGATGCTGGGAGG No data
1140897364_1140897370 23 Left 1140897364 16:79336406-79336428 CCAAGGTAGCTTCACTGGCAAAT No data
Right 1140897370 16:79336452-79336474 GCTTCTTCAGGGATGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140897370 Original CRISPR GCTTCTTCAGGGATGCTGGG AGG Intergenic
No off target data available for this crispr