ID: 1140899623

View in Genome Browser
Species Human (GRCh38)
Location 16:79355770-79355792
Sequence CCACTTTGCTAGTGGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140899623_1140899639 12 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899639 16:79355805-79355827 TGTGGGGAGGGGAACGTGGTGGG No data
1140899623_1140899631 -6 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899631 16:79355787-79355809 AAGTGGCTATGGGCGGCGTGTGG No data
1140899623_1140899638 11 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899638 16:79355804-79355826 GTGTGGGGAGGGGAACGTGGTGG No data
1140899623_1140899640 13 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899640 16:79355806-79355828 GTGGGGAGGGGAACGTGGTGGGG No data
1140899623_1140899633 -4 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899633 16:79355789-79355811 GTGGCTATGGGCGGCGTGTGGGG No data
1140899623_1140899632 -5 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899632 16:79355788-79355810 AGTGGCTATGGGCGGCGTGTGGG No data
1140899623_1140899635 0 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899635 16:79355793-79355815 CTATGGGCGGCGTGTGGGGAGGG No data
1140899623_1140899634 -1 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899634 16:79355792-79355814 GCTATGGGCGGCGTGTGGGGAGG No data
1140899623_1140899636 1 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899636 16:79355794-79355816 TATGGGCGGCGTGTGGGGAGGGG No data
1140899623_1140899637 8 Left 1140899623 16:79355770-79355792 CCCGGCCTCCACTAGCAAAGTGG No data
Right 1140899637 16:79355801-79355823 GGCGTGTGGGGAGGGGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140899623 Original CRISPR CCACTTTGCTAGTGGAGGCC GGG (reversed) Intergenic
No off target data available for this crispr