ID: 1140900046

View in Genome Browser
Species Human (GRCh38)
Location 16:79358860-79358882
Sequence TGCTGCAGAGGCTGCTCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140900041_1140900046 12 Left 1140900041 16:79358825-79358847 CCTGGGGAGTCTGAGATTGAGGT No data
Right 1140900046 16:79358860-79358882 TGCTGCAGAGGCTGCTCCGATGG No data
1140900038_1140900046 18 Left 1140900038 16:79358819-79358841 CCCATTCCTGGGGAGTCTGAGAT No data
Right 1140900046 16:79358860-79358882 TGCTGCAGAGGCTGCTCCGATGG No data
1140900039_1140900046 17 Left 1140900039 16:79358820-79358842 CCATTCCTGGGGAGTCTGAGATT No data
Right 1140900046 16:79358860-79358882 TGCTGCAGAGGCTGCTCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140900046 Original CRISPR TGCTGCAGAGGCTGCTCCGA TGG Intergenic