ID: 1140901579

View in Genome Browser
Species Human (GRCh38)
Location 16:79372810-79372832
Sequence CAGTGGGTCTGGAGCTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140901579_1140901585 25 Left 1140901579 16:79372810-79372832 CCCTCTCAGCTCCAGACCCACTG No data
Right 1140901585 16:79372858-79372880 ACCTATTTCTCACCCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140901579 Original CRISPR CAGTGGGTCTGGAGCTGAGA GGG (reversed) Intergenic
No off target data available for this crispr