ID: 1140902653

View in Genome Browser
Species Human (GRCh38)
Location 16:79384100-79384122
Sequence CCTAGAACAGGAAGGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140902645_1140902653 8 Left 1140902645 16:79384069-79384091 CCTCCTGAGTTGTACAATCGGGA No data
Right 1140902653 16:79384100-79384122 CCTAGAACAGGAAGGGAGTCAGG No data
1140902646_1140902653 5 Left 1140902646 16:79384072-79384094 CCTGAGTTGTACAATCGGGATGA No data
Right 1140902653 16:79384100-79384122 CCTAGAACAGGAAGGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140902653 Original CRISPR CCTAGAACAGGAAGGGAGTC AGG Intergenic
No off target data available for this crispr