ID: 1140903752

View in Genome Browser
Species Human (GRCh38)
Location 16:79393242-79393264
Sequence CCAGTCTGTAGGTACAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140903752_1140903759 0 Left 1140903752 16:79393242-79393264 CCTGGGCTGTACCTACAGACTGG No data
Right 1140903759 16:79393265-79393287 ATTCCAAAGGGATTTCTTTGGGG No data
1140903752_1140903757 -2 Left 1140903752 16:79393242-79393264 CCTGGGCTGTACCTACAGACTGG No data
Right 1140903757 16:79393263-79393285 GGATTCCAAAGGGATTTCTTTGG No data
1140903752_1140903760 1 Left 1140903752 16:79393242-79393264 CCTGGGCTGTACCTACAGACTGG No data
Right 1140903760 16:79393266-79393288 TTCCAAAGGGATTTCTTTGGGGG No data
1140903752_1140903765 24 Left 1140903752 16:79393242-79393264 CCTGGGCTGTACCTACAGACTGG No data
Right 1140903765 16:79393289-79393311 TTGGCTATTCCCTTGCAGGGTGG No data
1140903752_1140903763 20 Left 1140903752 16:79393242-79393264 CCTGGGCTGTACCTACAGACTGG No data
Right 1140903763 16:79393285-79393307 GGGGTTGGCTATTCCCTTGCAGG No data
1140903752_1140903766 25 Left 1140903752 16:79393242-79393264 CCTGGGCTGTACCTACAGACTGG No data
Right 1140903766 16:79393290-79393312 TGGCTATTCCCTTGCAGGGTGGG No data
1140903752_1140903758 -1 Left 1140903752 16:79393242-79393264 CCTGGGCTGTACCTACAGACTGG No data
Right 1140903758 16:79393264-79393286 GATTCCAAAGGGATTTCTTTGGG No data
1140903752_1140903764 21 Left 1140903752 16:79393242-79393264 CCTGGGCTGTACCTACAGACTGG No data
Right 1140903764 16:79393286-79393308 GGGTTGGCTATTCCCTTGCAGGG No data
1140903752_1140903762 5 Left 1140903752 16:79393242-79393264 CCTGGGCTGTACCTACAGACTGG No data
Right 1140903762 16:79393270-79393292 AAAGGGATTTCTTTGGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140903752 Original CRISPR CCAGTCTGTAGGTACAGCCC AGG (reversed) Intergenic
No off target data available for this crispr