ID: 1140904452

View in Genome Browser
Species Human (GRCh38)
Location 16:79398487-79398509
Sequence AAGAGGAATGAGAAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140904449_1140904452 -9 Left 1140904449 16:79398473-79398495 CCAATCTGCTGCAGAAGAGGAAT No data
Right 1140904452 16:79398487-79398509 AAGAGGAATGAGAAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140904452 Original CRISPR AAGAGGAATGAGAAGATGGA GGG Intergenic
No off target data available for this crispr