ID: 1140906163

View in Genome Browser
Species Human (GRCh38)
Location 16:79411072-79411094
Sequence GTGAATAAAGGCAAGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140906163_1140906172 28 Left 1140906163 16:79411072-79411094 CCTTTGATCTTGCCTTTATTCAC No data
Right 1140906172 16:79411123-79411145 CCACTCCCCAGTCACTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140906163 Original CRISPR GTGAATAAAGGCAAGATCAA AGG (reversed) Intergenic
No off target data available for this crispr