ID: 1140906304

View in Genome Browser
Species Human (GRCh38)
Location 16:79412298-79412320
Sequence CCGTGGTACCAGGTATGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140906300_1140906304 -6 Left 1140906300 16:79412281-79412303 CCTAGAGGGTATGATTACCGTGG No data
Right 1140906304 16:79412298-79412320 CCGTGGTACCAGGTATGTGCAGG No data
1140906299_1140906304 -5 Left 1140906299 16:79412280-79412302 CCCTAGAGGGTATGATTACCGTG No data
Right 1140906304 16:79412298-79412320 CCGTGGTACCAGGTATGTGCAGG No data
1140906298_1140906304 5 Left 1140906298 16:79412270-79412292 CCAGTTGACACCCTAGAGGGTAT No data
Right 1140906304 16:79412298-79412320 CCGTGGTACCAGGTATGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140906304 Original CRISPR CCGTGGTACCAGGTATGTGC AGG Intergenic
No off target data available for this crispr