ID: 1140906964

View in Genome Browser
Species Human (GRCh38)
Location 16:79417403-79417425
Sequence CATTCTATTTTGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140906957_1140906964 -5 Left 1140906957 16:79417385-79417407 CCTGGCAGTATCTATCCCCATTC No data
Right 1140906964 16:79417403-79417425 CATTCTATTTTGAAGGTGGAGGG No data
1140906955_1140906964 13 Left 1140906955 16:79417367-79417389 CCAAACATCAAAAGAACTCCTGG No data
Right 1140906964 16:79417403-79417425 CATTCTATTTTGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140906964 Original CRISPR CATTCTATTTTGAAGGTGGA GGG Intergenic
No off target data available for this crispr