ID: 1140906964 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:79417403-79417425 |
| Sequence | CATTCTATTTTGAAGGTGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1140906957_1140906964 | -5 | Left | 1140906957 | 16:79417385-79417407 | CCTGGCAGTATCTATCCCCATTC | No data | ||
| Right | 1140906964 | 16:79417403-79417425 | CATTCTATTTTGAAGGTGGAGGG | No data | ||||
| 1140906955_1140906964 | 13 | Left | 1140906955 | 16:79417367-79417389 | CCAAACATCAAAAGAACTCCTGG | No data | ||
| Right | 1140906964 | 16:79417403-79417425 | CATTCTATTTTGAAGGTGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1140906964 | Original CRISPR | CATTCTATTTTGAAGGTGGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||