ID: 1140908237

View in Genome Browser
Species Human (GRCh38)
Location 16:79428434-79428456
Sequence TGGGACTCCAAGGGAGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140908237_1140908244 3 Left 1140908237 16:79428434-79428456 CCTGTTGCTCCCTTGGAGTCCCA No data
Right 1140908244 16:79428460-79428482 TGGCATTTTCCTTTCAATTTGGG No data
1140908237_1140908243 2 Left 1140908237 16:79428434-79428456 CCTGTTGCTCCCTTGGAGTCCCA No data
Right 1140908243 16:79428459-79428481 CTGGCATTTTCCTTTCAATTTGG No data
1140908237_1140908246 9 Left 1140908237 16:79428434-79428456 CCTGTTGCTCCCTTGGAGTCCCA No data
Right 1140908246 16:79428466-79428488 TTTCCTTTCAATTTGGGGCGAGG No data
1140908237_1140908245 4 Left 1140908237 16:79428434-79428456 CCTGTTGCTCCCTTGGAGTCCCA No data
Right 1140908245 16:79428461-79428483 GGCATTTTCCTTTCAATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140908237 Original CRISPR TGGGACTCCAAGGGAGCAAC AGG (reversed) Intergenic
No off target data available for this crispr