ID: 1140909217

View in Genome Browser
Species Human (GRCh38)
Location 16:79436770-79436792
Sequence ACCCAGCTCATGTTTCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140909217_1140909222 18 Left 1140909217 16:79436770-79436792 CCTCTTGGAAACATGAGCTGGGT No data
Right 1140909222 16:79436811-79436833 AGCACTCCACCATGCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140909217 Original CRISPR ACCCAGCTCATGTTTCCAAG AGG (reversed) Intergenic