ID: 1140909374

View in Genome Browser
Species Human (GRCh38)
Location 16:79437910-79437932
Sequence GGAGGTTTCCGCCTCTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140909362_1140909374 11 Left 1140909362 16:79437876-79437898 CCCCTTTCACCTAGAGTGGGACA No data
Right 1140909374 16:79437910-79437932 GGAGGTTTCCGCCTCTGCAGGGG No data
1140909366_1140909374 2 Left 1140909366 16:79437885-79437907 CCTAGAGTGGGACACAGGCCAGG No data
Right 1140909374 16:79437910-79437932 GGAGGTTTCCGCCTCTGCAGGGG No data
1140909364_1140909374 9 Left 1140909364 16:79437878-79437900 CCTTTCACCTAGAGTGGGACACA No data
Right 1140909374 16:79437910-79437932 GGAGGTTTCCGCCTCTGCAGGGG No data
1140909359_1140909374 18 Left 1140909359 16:79437869-79437891 CCGCATTCCCCTTTCACCTAGAG No data
Right 1140909374 16:79437910-79437932 GGAGGTTTCCGCCTCTGCAGGGG No data
1140909363_1140909374 10 Left 1140909363 16:79437877-79437899 CCCTTTCACCTAGAGTGGGACAC No data
Right 1140909374 16:79437910-79437932 GGAGGTTTCCGCCTCTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140909374 Original CRISPR GGAGGTTTCCGCCTCTGCAG GGG Intergenic
No off target data available for this crispr