ID: 1140911548

View in Genome Browser
Species Human (GRCh38)
Location 16:79457771-79457793
Sequence GTGATCAAGGCACCCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140911538_1140911548 28 Left 1140911538 16:79457720-79457742 CCTCAAATGAGGATTAAGCTTAA No data
Right 1140911548 16:79457771-79457793 GTGATCAAGGCACCCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140911548 Original CRISPR GTGATCAAGGCACCCCAAGA AGG Intergenic
No off target data available for this crispr