ID: 1140913281

View in Genome Browser
Species Human (GRCh38)
Location 16:79472880-79472902
Sequence TACCCAAATCTCTCCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140913281_1140913287 21 Left 1140913281 16:79472880-79472902 CCTGTCCTGGAGAGATTTGGGTA No data
Right 1140913287 16:79472924-79472946 TACCGAGGCCCGGTACCATATGG No data
1140913281_1140913286 11 Left 1140913281 16:79472880-79472902 CCTGTCCTGGAGAGATTTGGGTA No data
Right 1140913286 16:79472914-79472936 AATGGGTGTGTACCGAGGCCCGG No data
1140913281_1140913285 6 Left 1140913281 16:79472880-79472902 CCTGTCCTGGAGAGATTTGGGTA No data
Right 1140913285 16:79472909-79472931 GATTGAATGGGTGTGTACCGAGG No data
1140913281_1140913283 -7 Left 1140913281 16:79472880-79472902 CCTGTCCTGGAGAGATTTGGGTA No data
Right 1140913283 16:79472896-79472918 TTGGGTAGTCAGTGATTGAATGG No data
1140913281_1140913284 -6 Left 1140913281 16:79472880-79472902 CCTGTCCTGGAGAGATTTGGGTA No data
Right 1140913284 16:79472897-79472919 TGGGTAGTCAGTGATTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140913281 Original CRISPR TACCCAAATCTCTCCAGGAC AGG (reversed) Intergenic
No off target data available for this crispr