ID: 1140914328

View in Genome Browser
Species Human (GRCh38)
Location 16:79481172-79481194
Sequence TACCCAAATCTCTCCAGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140914325_1140914328 -6 Left 1140914325 16:79481155-79481177 CCTGTTCAATCACTTACTACCCA No data
Right 1140914328 16:79481172-79481194 TACCCAAATCTCTCCAGGACGGG No data
1140914324_1140914328 6 Left 1140914324 16:79481143-79481165 CCTCAGTACACACCTGTTCAATC No data
Right 1140914328 16:79481172-79481194 TACCCAAATCTCTCCAGGACGGG No data
1140914323_1140914328 21 Left 1140914323 16:79481128-79481150 CCATGTGTTGCTTGGCCTCAGTA No data
Right 1140914328 16:79481172-79481194 TACCCAAATCTCTCCAGGACGGG No data
1140914322_1140914328 22 Left 1140914322 16:79481127-79481149 CCCATGTGTTGCTTGGCCTCAGT No data
Right 1140914328 16:79481172-79481194 TACCCAAATCTCTCCAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140914328 Original CRISPR TACCCAAATCTCTCCAGGAC GGG Intergenic
No off target data available for this crispr