ID: 1140922302

View in Genome Browser
Species Human (GRCh38)
Location 16:79550680-79550702
Sequence TTCTACCCAGCAATAACAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140922302_1140922304 -9 Left 1140922302 16:79550680-79550702 CCGCCTGTTATTGCTGGGTAGAA No data
Right 1140922304 16:79550694-79550716 TGGGTAGAATTTGCCTAGTTTGG No data
1140922302_1140922309 24 Left 1140922302 16:79550680-79550702 CCGCCTGTTATTGCTGGGTAGAA No data
Right 1140922309 16:79550727-79550749 ATTTTGCACCATCTAATCTGTGG No data
1140922302_1140922307 1 Left 1140922302 16:79550680-79550702 CCGCCTGTTATTGCTGGGTAGAA No data
Right 1140922307 16:79550704-79550726 TTGCCTAGTTTGGGTATGGTAGG No data
1140922302_1140922305 -8 Left 1140922302 16:79550680-79550702 CCGCCTGTTATTGCTGGGTAGAA No data
Right 1140922305 16:79550695-79550717 GGGTAGAATTTGCCTAGTTTGGG No data
1140922302_1140922306 -3 Left 1140922302 16:79550680-79550702 CCGCCTGTTATTGCTGGGTAGAA No data
Right 1140922306 16:79550700-79550722 GAATTTGCCTAGTTTGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140922302 Original CRISPR TTCTACCCAGCAATAACAGG CGG (reversed) Intergenic