ID: 1140922303

View in Genome Browser
Species Human (GRCh38)
Location 16:79550683-79550705
Sequence AAATTCTACCCAGCAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140922303_1140922310 28 Left 1140922303 16:79550683-79550705 CCTGTTATTGCTGGGTAGAATTT No data
Right 1140922310 16:79550734-79550756 ACCATCTAATCTGTGGCTAGAGG No data
1140922303_1140922306 -6 Left 1140922303 16:79550683-79550705 CCTGTTATTGCTGGGTAGAATTT No data
Right 1140922306 16:79550700-79550722 GAATTTGCCTAGTTTGGGTATGG No data
1140922303_1140922309 21 Left 1140922303 16:79550683-79550705 CCTGTTATTGCTGGGTAGAATTT No data
Right 1140922309 16:79550727-79550749 ATTTTGCACCATCTAATCTGTGG No data
1140922303_1140922307 -2 Left 1140922303 16:79550683-79550705 CCTGTTATTGCTGGGTAGAATTT No data
Right 1140922307 16:79550704-79550726 TTGCCTAGTTTGGGTATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140922303 Original CRISPR AAATTCTACCCAGCAATAAC AGG (reversed) Intergenic
No off target data available for this crispr