ID: 1140922304

View in Genome Browser
Species Human (GRCh38)
Location 16:79550694-79550716
Sequence TGGGTAGAATTTGCCTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140922302_1140922304 -9 Left 1140922302 16:79550680-79550702 CCGCCTGTTATTGCTGGGTAGAA No data
Right 1140922304 16:79550694-79550716 TGGGTAGAATTTGCCTAGTTTGG No data
1140922299_1140922304 -1 Left 1140922299 16:79550672-79550694 CCATCTCACCGCCTGTTATTGCT No data
Right 1140922304 16:79550694-79550716 TGGGTAGAATTTGCCTAGTTTGG No data
1140922297_1140922304 28 Left 1140922297 16:79550643-79550665 CCTCATGATATCTCACTCACTGC No data
Right 1140922304 16:79550694-79550716 TGGGTAGAATTTGCCTAGTTTGG No data
1140922298_1140922304 6 Left 1140922298 16:79550665-79550687 CCTTTGTCCATCTCACCGCCTGT No data
Right 1140922304 16:79550694-79550716 TGGGTAGAATTTGCCTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140922304 Original CRISPR TGGGTAGAATTTGCCTAGTT TGG Intergenic
No off target data available for this crispr