ID: 1140922308

View in Genome Browser
Species Human (GRCh38)
Location 16:79550707-79550729
Sequence AATCCTACCATACCCAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140922308_1140922310 4 Left 1140922308 16:79550707-79550729 CCTAGTTTGGGTATGGTAGGATT No data
Right 1140922310 16:79550734-79550756 ACCATCTAATCTGTGGCTAGAGG No data
1140922308_1140922312 26 Left 1140922308 16:79550707-79550729 CCTAGTTTGGGTATGGTAGGATT No data
Right 1140922312 16:79550756-79550778 GAAGAGTCTCCTGAAATTTCAGG No data
1140922308_1140922309 -3 Left 1140922308 16:79550707-79550729 CCTAGTTTGGGTATGGTAGGATT No data
Right 1140922309 16:79550727-79550749 ATTTTGCACCATCTAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140922308 Original CRISPR AATCCTACCATACCCAAACT AGG (reversed) Intergenic
No off target data available for this crispr