ID: 1140922309

View in Genome Browser
Species Human (GRCh38)
Location 16:79550727-79550749
Sequence ATTTTGCACCATCTAATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140922308_1140922309 -3 Left 1140922308 16:79550707-79550729 CCTAGTTTGGGTATGGTAGGATT No data
Right 1140922309 16:79550727-79550749 ATTTTGCACCATCTAATCTGTGG No data
1140922303_1140922309 21 Left 1140922303 16:79550683-79550705 CCTGTTATTGCTGGGTAGAATTT No data
Right 1140922309 16:79550727-79550749 ATTTTGCACCATCTAATCTGTGG No data
1140922302_1140922309 24 Left 1140922302 16:79550680-79550702 CCGCCTGTTATTGCTGGGTAGAA No data
Right 1140922309 16:79550727-79550749 ATTTTGCACCATCTAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140922309 Original CRISPR ATTTTGCACCATCTAATCTG TGG Intergenic
No off target data available for this crispr