ID: 1140922659

View in Genome Browser
Species Human (GRCh38)
Location 16:79553264-79553286
Sequence CCATTGCCACCTCTCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140922650_1140922659 16 Left 1140922650 16:79553225-79553247 CCGTTCCTCAAGGCACAGCAACT No data
Right 1140922659 16:79553264-79553286 CCATTGCCACCTCTCCATCATGG No data
1140922651_1140922659 11 Left 1140922651 16:79553230-79553252 CCTCAAGGCACAGCAACTCCAGG No data
Right 1140922659 16:79553264-79553286 CCATTGCCACCTCTCCATCATGG No data
1140922656_1140922659 -7 Left 1140922656 16:79553248-79553270 CCAGGGAAGGCCTTGGCCATTGC No data
Right 1140922659 16:79553264-79553286 CCATTGCCACCTCTCCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140922659 Original CRISPR CCATTGCCACCTCTCCATCA TGG Intergenic
No off target data available for this crispr