ID: 1140925304

View in Genome Browser
Species Human (GRCh38)
Location 16:79576797-79576819
Sequence GGTAATGTATGTAAAGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140925304_1140925307 8 Left 1140925304 16:79576797-79576819 CCAGGTGCTTTACATACATTACC No data
Right 1140925307 16:79576828-79576850 TCCTCTACACATGCCTTTGAGGG No data
1140925304_1140925306 7 Left 1140925304 16:79576797-79576819 CCAGGTGCTTTACATACATTACC No data
Right 1140925306 16:79576827-79576849 GTCCTCTACACATGCCTTTGAGG No data
1140925304_1140925309 9 Left 1140925304 16:79576797-79576819 CCAGGTGCTTTACATACATTACC No data
Right 1140925309 16:79576829-79576851 CCTCTACACATGCCTTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140925304 Original CRISPR GGTAATGTATGTAAAGCACC TGG (reversed) Intergenic
No off target data available for this crispr