ID: 1140925307

View in Genome Browser
Species Human (GRCh38)
Location 16:79576828-79576850
Sequence TCCTCTACACATGCCTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140925304_1140925307 8 Left 1140925304 16:79576797-79576819 CCAGGTGCTTTACATACATTACC No data
Right 1140925307 16:79576828-79576850 TCCTCTACACATGCCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140925307 Original CRISPR TCCTCTACACATGCCTTTGA GGG Intergenic
No off target data available for this crispr