ID: 1140925879

View in Genome Browser
Species Human (GRCh38)
Location 16:79583018-79583040
Sequence ATATGTTGATGGGTTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140925876_1140925879 -9 Left 1140925876 16:79583004-79583026 CCATTTCTGTTAAAATATGTTGA No data
Right 1140925879 16:79583018-79583040 ATATGTTGATGGGTTCTGCAAGG No data
1140925875_1140925879 3 Left 1140925875 16:79582992-79583014 CCACGTGGTTCACCATTTCTGTT No data
Right 1140925879 16:79583018-79583040 ATATGTTGATGGGTTCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140925879 Original CRISPR ATATGTTGATGGGTTCTGCA AGG Intergenic
No off target data available for this crispr