ID: 1140929285

View in Genome Browser
Species Human (GRCh38)
Location 16:79611993-79612015
Sequence CCTCTAAGGCAGTGCCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140929285_1140929297 30 Left 1140929285 16:79611993-79612015 CCCCTTAGGCACTGCCTTAGAGG No data
Right 1140929297 16:79612046-79612068 ACAAGATGTAAATCCAGGCATGG No data
1140929285_1140929293 1 Left 1140929285 16:79611993-79612015 CCCCTTAGGCACTGCCTTAGAGG No data
Right 1140929293 16:79612017-79612039 CTTTTCCAGGGCCACATAGCAGG No data
1140929285_1140929296 25 Left 1140929285 16:79611993-79612015 CCCCTTAGGCACTGCCTTAGAGG No data
Right 1140929296 16:79612041-79612063 GTAGTACAAGATGTAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140929285 Original CRISPR CCTCTAAGGCAGTGCCTAAG GGG (reversed) Intergenic
No off target data available for this crispr