ID: 1140946286

View in Genome Browser
Species Human (GRCh38)
Location 16:79770929-79770951
Sequence CCAAATTCTGACGCGGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140946281_1140946286 1 Left 1140946281 16:79770905-79770927 CCCAGCTCATGCATGCTTTAGTC No data
Right 1140946286 16:79770929-79770951 CCAAATTCTGACGCGGACGGAGG No data
1140946277_1140946286 28 Left 1140946277 16:79770878-79770900 CCTTTCCCTTTGCAACTTGTCAC No data
Right 1140946286 16:79770929-79770951 CCAAATTCTGACGCGGACGGAGG No data
1140946275_1140946286 30 Left 1140946275 16:79770876-79770898 CCCCTTTCCCTTTGCAACTTGTC No data
Right 1140946286 16:79770929-79770951 CCAAATTCTGACGCGGACGGAGG No data
1140946280_1140946286 6 Left 1140946280 16:79770900-79770922 CCATTCCCAGCTCATGCATGCTT No data
Right 1140946286 16:79770929-79770951 CCAAATTCTGACGCGGACGGAGG No data
1140946276_1140946286 29 Left 1140946276 16:79770877-79770899 CCCTTTCCCTTTGCAACTTGTCA No data
Right 1140946286 16:79770929-79770951 CCAAATTCTGACGCGGACGGAGG No data
1140946282_1140946286 0 Left 1140946282 16:79770906-79770928 CCAGCTCATGCATGCTTTAGTCG No data
Right 1140946286 16:79770929-79770951 CCAAATTCTGACGCGGACGGAGG No data
1140946279_1140946286 22 Left 1140946279 16:79770884-79770906 CCTTTGCAACTTGTCACCATTCC No data
Right 1140946286 16:79770929-79770951 CCAAATTCTGACGCGGACGGAGG No data
1140946278_1140946286 23 Left 1140946278 16:79770883-79770905 CCCTTTGCAACTTGTCACCATTC No data
Right 1140946286 16:79770929-79770951 CCAAATTCTGACGCGGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140946286 Original CRISPR CCAAATTCTGACGCGGACGG AGG Intergenic