ID: 1140950473

View in Genome Browser
Species Human (GRCh38)
Location 16:79812284-79812306
Sequence AGTCCAGAGGGAGCTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140950468_1140950473 17 Left 1140950468 16:79812244-79812266 CCATGATGAGGAAGTGGGGTCTC No data
Right 1140950473 16:79812284-79812306 AGTCCAGAGGGAGCTCCCACAGG No data
1140950470_1140950473 -7 Left 1140950470 16:79812268-79812290 CCTCACACAGGATCACAGTCCAG No data
Right 1140950473 16:79812284-79812306 AGTCCAGAGGGAGCTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140950473 Original CRISPR AGTCCAGAGGGAGCTCCCAC AGG Intergenic
No off target data available for this crispr