ID: 1140950898

View in Genome Browser
Species Human (GRCh38)
Location 16:79816389-79816411
Sequence GCTGAAGGTGGGACACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140950898_1140950905 27 Left 1140950898 16:79816389-79816411 CCAGGCTGTGTCCCACCTTCAGC No data
Right 1140950905 16:79816439-79816461 GATAATGCCACGCCAGAATGTGG No data
1140950898_1140950906 30 Left 1140950898 16:79816389-79816411 CCAGGCTGTGTCCCACCTTCAGC No data
Right 1140950906 16:79816442-79816464 AATGCCACGCCAGAATGTGGAGG No data
1140950898_1140950903 5 Left 1140950898 16:79816389-79816411 CCAGGCTGTGTCCCACCTTCAGC No data
Right 1140950903 16:79816417-79816439 GTAAGAAGGTTACAGCTTCCTGG No data
1140950898_1140950901 -9 Left 1140950898 16:79816389-79816411 CCAGGCTGTGTCCCACCTTCAGC No data
Right 1140950901 16:79816403-79816425 ACCTTCAGCTGTCAGTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140950898 Original CRISPR GCTGAAGGTGGGACACAGCC TGG (reversed) Intergenic
No off target data available for this crispr