ID: 1140953178

View in Genome Browser
Species Human (GRCh38)
Location 16:79838503-79838525
Sequence TACGTGTTTTGCGGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140953178_1140953182 -10 Left 1140953178 16:79838503-79838525 CCAAGAGCCCCGCAAAACACGTA No data
Right 1140953182 16:79838516-79838538 AAAACACGTACTTTCGTTTACGG No data
1140953178_1140953185 25 Left 1140953178 16:79838503-79838525 CCAAGAGCCCCGCAAAACACGTA No data
Right 1140953185 16:79838551-79838573 AGCAACAGTTTAGTGGCAGATGG No data
1140953178_1140953184 18 Left 1140953178 16:79838503-79838525 CCAAGAGCCCCGCAAAACACGTA No data
Right 1140953184 16:79838544-79838566 CAAATGCAGCAACAGTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140953178 Original CRISPR TACGTGTTTTGCGGGGCTCT TGG (reversed) Intergenic
No off target data available for this crispr