ID: 1140957607

View in Genome Browser
Species Human (GRCh38)
Location 16:79880074-79880096
Sequence AAACTAGTATTGTGATAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140957607_1140957609 4 Left 1140957607 16:79880074-79880096 CCACTCTATCACAATACTAGTTT No data
Right 1140957609 16:79880101-79880123 TTGACTTTTTAGGTAACTTATGG No data
1140957607_1140957608 -6 Left 1140957607 16:79880074-79880096 CCACTCTATCACAATACTAGTTT No data
Right 1140957608 16:79880091-79880113 TAGTTTTCAGTTGACTTTTTAGG No data
1140957607_1140957610 10 Left 1140957607 16:79880074-79880096 CCACTCTATCACAATACTAGTTT No data
Right 1140957610 16:79880107-79880129 TTTTAGGTAACTTATGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140957607 Original CRISPR AAACTAGTATTGTGATAGAG TGG (reversed) Intergenic
No off target data available for this crispr