ID: 1140958886

View in Genome Browser
Species Human (GRCh38)
Location 16:79893759-79893781
Sequence CAGGGTAAAAAGGATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140958881_1140958886 -5 Left 1140958881 16:79893741-79893763 CCATGCTTTAGTATCTTCCAGGG No data
Right 1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG No data
1140958877_1140958886 12 Left 1140958877 16:79893724-79893746 CCATGGGAAAATTCTCCCCATGC No data
Right 1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG No data
1140958878_1140958886 -3 Left 1140958878 16:79893739-79893761 CCCCATGCTTTAGTATCTTCCAG No data
Right 1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG No data
1140958879_1140958886 -4 Left 1140958879 16:79893740-79893762 CCCATGCTTTAGTATCTTCCAGG No data
Right 1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG No data
1140958876_1140958886 16 Left 1140958876 16:79893720-79893742 CCGGCCATGGGAAAATTCTCCCC No data
Right 1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140958886 Original CRISPR CAGGGTAAAAAGGATGAGGC AGG Intergenic
No off target data available for this crispr