ID: 1140959989

View in Genome Browser
Species Human (GRCh38)
Location 16:79902520-79902542
Sequence CTTATGTGCCAGGACTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140959983_1140959989 26 Left 1140959983 16:79902471-79902493 CCATAGTTGATATTCTGACTCAG No data
Right 1140959989 16:79902520-79902542 CTTATGTGCCAGGACTCAGCTGG No data
1140959984_1140959989 -10 Left 1140959984 16:79902507-79902529 CCTCCTCCCACTTCTTATGTGCC No data
Right 1140959989 16:79902520-79902542 CTTATGTGCCAGGACTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140959989 Original CRISPR CTTATGTGCCAGGACTCAGC TGG Intergenic
No off target data available for this crispr