ID: 1140959998

View in Genome Browser
Species Human (GRCh38)
Location 16:79902584-79902606
Sequence CAGTGGAATATGGAGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140959998_1140960005 25 Left 1140959998 16:79902584-79902606 CCTGGTGGCTCCATATTCCACTG No data
Right 1140960005 16:79902632-79902654 CTCTGGACAAGAAAACTTCGAGG No data
1140959998_1140960002 8 Left 1140959998 16:79902584-79902606 CCTGGTGGCTCCATATTCCACTG No data
Right 1140960002 16:79902615-79902637 GAGCAGAATCCCGTGAACTCTGG No data
1140959998_1140960006 29 Left 1140959998 16:79902584-79902606 CCTGGTGGCTCCATATTCCACTG No data
Right 1140960006 16:79902636-79902658 GGACAAGAAAACTTCGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140959998 Original CRISPR CAGTGGAATATGGAGCCACC AGG (reversed) Intergenic
No off target data available for this crispr